Description :
From Genome Similarity Track
Location :
Scaffold_15:13154- 14264
Transcript NameFunction/comments
Sapdi_VS20SDRG_05599hypothetical protein

Sequence
1110 bases(100 bases per row)
ACGCGAGATGACAAGGCTACCTCATCACGCGCTCTTTGTCTCGCCGTGCTTGTACGACCGCGCCCTCGCACTTCATCTAACGATTGTTGAAGGTGACGTG
ACGCTCGTCCAGCAATGGCTGCGATGGGATGCCTCTCTGTGTACGTCGGCGACGCTCGAGCTTGCTGCTGCTGCGTCTCAAGGTCCGATTCTGCGTCTTC
TCTTCGAGCAGTTTCCAGCGCTGGCCACACCCAAGATGATGGACCTTGTCGCCATGTCGGGTGACCTCCCACTGCTCTTGTGGCTTCACGAGGCGGGCGT
GGCGTGCACCACTGCCGCGATGGACGGCGCGGCCATGAACGGTCACTATGACGTCGTCCTCTTCCTGCACTCTGCAAGGACCGAGGGCTGCACGATCGCG
GCGGCAACGGCAGCAGTGGTCAATGGTCACGCGTCGATCGTTCGCTTTCTTCTCGTGCAGCGCACCGAAAGCTTTGACCCATCGCTCATATTCAATGCAC
CGCATGTCGAGCACTTGACGCACAGTGTACTCGGCGAGGCGCATATTGAGGCTGTCGACCTCGTCGAGGCGACGGCGCAGTTGACCGACGCTGCGCTTCA
GACGATCGTCCACAGGGGGGGTCTCGCCGTCCTTGAACACGTCTACACACGTGGGTACGTTCCACGCATGACCAAGTCGAGAATGCAGTGCGCGCTCGCC
AAGCAAGACCACGCAATGCTGCGCTACGTTCTCGACTGCATCGACCAAGAGAACCCGCGACCACCGAGCGACGATGAATGGCTGCCACCGACCAACGTCG
GTTCGCACAAGTCGCCTCGGCACCCGAGTCCATTCGATCGGTGGGACTTTTGTACTCTCATGGATTTCGCGGCCTTCAACGGCGACCTGACGTCGCTGGA
GCTCTTGCACAAGAGCCGCCTGCGCGTCGGGTCGGGCCGATCTATCGCCTTGGCCGCGTACCGCGGACACACGCATGTTCTCGAATGGCTGCATACGAAC
CGACGCGATGGCTGTGACGAAGATGCGATGGCGCTCGCTGCTGGTCATGGCTACTTGGACGTTGTGCGCTGGCTCCACGAGGTCTACGGACTGTGTCGGA
CGAACGCTGC