Description :
From Genome Similarity Track
Location :
Scaffold_2:131531- 139601
Transcript NameFunction/comments
Phyta_totarag146hypothetical protein PHYSODRAFT_315962
Phyta_totarag147P-type ATPase (P-ATPase) Superfamily
Phyta_totarag148hypothetical protein

Sequence
8070 bases(100 bases per row)
TGAGACCACCACACCTCGTCCAAACGGAGTCACGATACGAGTCTTGTCCGCCAGAGGTGCCACACTTACAGCAGCCGGATGGTGTGCATCGACGTCGAAT
TTGTTGCCAGGCAGGTAAAGCGCAGCTTTTGCAGTCTCTCTGCCAAATGCGGCAGGGTGTCGTACAGGTGCATTCACTAGTCGTGCAGTGGTCTTGTATC
GCTCGATATCGTCATCGTTCTCACGTTTCTTCTGTCGGAGCAGAGCCAGCACACGCTCGTGACGCTCACGCACCGAGTACTCGAACGtgacgcgcagcag
cagctttccaGTGACGCCAGTAGTCACTGCAGACGCCGGTGCTTTCAAGTCGAACCACTTCTCGTGTGGTACTTGGTCCTCATAGTCGGTGCtacgcagc
tccagctctccAAGCACCACATCAGCAATGACCTCAGcactgcagctcagcgagaCCTTGATGCCGAACTTCTTAGTCTTGGCTCCTTCATACACAAGTG
GCTCCTGCCAGCTAGCAATAGCACTGTCCACTACTTGCACGCTGCTAGTGCGCAGGTGCTTCTTCGTGGTCTTCTCGAACGCCGACAGCGGCGTAACCTG
CGTGGACACGTACAGATCCGGCTTCGCATTGCCACTGACCGCCAGCACCGctgcgttcttctccagcgctAGGTCCTTGGCCGccagcacttcaactgcc
ACGCGACCTGCAGCCTTGCCCGTCTTTgcgtccacgtccacgccGTTCTTGTTCAGTTTGCCAGCAGCTAATGCAGCGGCCGCTACCTGCTCGGCGTGCT
GTAActcgtgctccagctgcacagacagcagctccagcggcgacaaCGCCACCTTCTCCCACATGAGCGAGCTGCCAAGCCCCACGGACGACACCGGCGA
GTCACTTAGCGATTGCACGTCGCTCATGCCTTTCTGAGCGAGAGAGTGATGGATatgaagttgtcgatgatCAACGCGCAATCACGGTTCCGGTCCGGTT
CGCATAGGATTCTGATCCTAACCGGTCCTATCTGATTCCAGCAACTTTCAGATTATATTCACCTGATAATTTCTCTGATCCCATAAATAGACTACCGTAA
TCCGCGTCGCCTCATTTCCTCGGCGCATATAACGCAAGATGCGGATCCAGGCGGAGGCTGCGGCGGGCAGCTCCACGACTTCGGAAGACTCCGGTCAAAG
CCTGCGCGTGATCCGCGTGGACCGGAAGACGCTCGTGGCGCGCGCAAACGCGGCTCAgcgtcgctgccgccacGAGGAGCGCGAGGCGCGTCGTCTGGGC
AATCGCGCGCGATCGTCGTGGCTGTTCGGAGGCGCCAAGAGACCGCAGGAAGACGCCGTGGAGCCGCCATCACCCTTCGCCAgcaacgtggtggtgagTG
CCAAATACAGCGCCTGGAATTTCGCGCCGCgcgtgctgcttgcgcaGTTGCAGCGGCCCTCGAACGTGTATTTCTTGTTTATCGCGGTGCTCCAGACCAT
CCGAGAAGTGAGCAACACGAGCGGCATCCCGACGATTCTGCTGCCACTGGCAGTGGTGTTTGTGTGTAGTGCAATTAAAGAGGCACTGGAGGACCGAGAA
CGTCACCGAGCAGACCGTGTGGCAAACAGTCGACCGGTACTGACACTCACCCCCTTGGGCAGTTGGGAGCAGAGGCAATGGGGAGACCTACACGTAGGAG
ATATCGTCAAGGTGATGAATGGCCAGACTATCCCGGCGGACTTGTTCCTGCTGTCGGCGGAAGCAGTGGAGCACGATGATGAGAGTGAGAGGCGACAACA
GGTACAGTCAACAGAGACGGCGAATCCGAGAGAACTGCAGCCCCCGGGTGATCTGGAGGATGGAAGGAGTACTACAGACGACACTTCGGGACTTCCTGTA
GCCGTAAGAGATGATCAAGTATCACAGAGACCGGCTTCACTAGAGGCGCAGACAGCGGAGATCAATCTGGCGTACATCGAGACGAAGTCGCTGGACGGTG
AAACCAACCTCAAGATCCGTACGGCCATTCCGTTAGTGGCTGCACTTTGTCGAGGATCGAGCTGCAAGAATCGCACTATTGACGGTGGTGGACATAACGA
GCTGCGTGGTATGATGATGTGCGAACTGCCAAACAATCGTATTACCAGTTTTGAAGGCACTTTTTCGACCGTATTAAGCCCGGATCAAGCACAGACGTTG
GGCGTTGGTGACGGTGACCCAAATAATGCAAGCCGCTCTTCTCAGCCGGCAGTCCCGGTGCAGCCTACTGCTGGCCTCTTACAGACAGAAACGACGGGGG
ATGGCCTTGTGCGTGTGCGCATGCCAGTTACGGCAAAGCAGATGATGCTGCGGAGTTGTGTGCTTCGGAATACAGGCTCAGTCACAGGCATGGTGGTGTT
CACTGGGCACGAGACCAAGGTGTTTTGCAGCAACACTGAGCCCGTTGTGAAGACCTCATCAGTGGAGAGGCGACTTAACCGACTCATTATCGGTATTGTA
TTTATCCAGCAGTTCGTTTGTTTTCTGAGTGCGTTGCTTGGTGCGCACTGGATGCATACAGAGGGAAACTCGTTCTGGTATCTTCTCAGTGCAAATGAGC
GGCGACATCACAACTTGACTGGCGCTCCTACTTCTCATCCTCTGGCTGAGCTCGCGAAATTGCACCTGCGGTACTTCATCATCATGCAAAACTTTGTCCC
CATATCACTGAATGTGTCGCTGGAGTTCGTCAAATATTGGCAAGCCTACTTTATTGAGCAGGACCTAGAAATGTACGACAAGCCGTCCGATACGCCGGCT
ATGGTTCGATCATCAGCTCTTAATGAAGATCTCGGCCGCGTGCACCATGTCTTTACGGACAAGACTGGTACCCTCACGATGAACCTCATGCTTTTTCGTC
ACTGCATGGTGGGAGGAAAGCATTACGGTGGTCTCATGCAAGAGAAAGACATTGAGGCGGATGTTGCCAGCGAAGCCTCTTCCTCTCTGGGTGCTGCTTC
GAAGGATGGTCCAAGGTTTGTTGACTTCGACCCAACGGAACTCTTCGCTGATATTCAGGCGGGTGGAGAGCAGGCGGAAACTCTCCGCCGCTTTTTACGA
CACTTAGCATTGTGCCATACGCTAATCCCCACCAAATCTCTCGCAGAAATGTGTAGTACGTCGTTCCCGGAGTATTCTGCGTCGTCACCCGACGAGCAAG
CGTTGGTGTCTGCAGCGGCATTCTGTAACGTGCGCTTCGTGCACAGGACACCCACTGCCATGATGCTCTTGGAGCCGGGGGGGGTAACACCTAGCACATA
CAAATTACTGAACGTACTCGAGTTCGATAGCGATCGAAAGCGCATGACAGTGATCGTGGAGACCCCAGACGGATCAATTGAACTTCTTTGCAAAGGTGCT
GACAACGTCATTTTCGAGCGACTTGCTCCCGATCAAGCGACATTGTCTGGTGACATGTCTTATGAACAAGCTGCGGATCAACTTACACTGTACGCGAAAA
CTGGCATGCGTACACTTTGCCTTGCGTACAAGACTATTGACCGGCGTGAGTACGAGGATTGGAACGCTCGTTATACGCAAGCACATAGTTCCATGGAGGA
GTTAGTGAAACGGCGCCAAGGTCATGCGAACGCGATTGACCCACTCATGAACGAGATTGAGCGCGATCTGGTTCTTCTCGGAGTCACAGCTGTCCAAGAC
AAACTGCAGGCTGGTGTGCCTGCGACGCTACGTCTGCTGCAAGAGACTAAAATTAAGGTTTGGACACTAACCGGCGACAAAATGGAGACTGCTGTGAACA
TTGGATACGCCAGTGCGCTGCTTTCTCACGACATGGACGTTCAACAAATTGGTGGTGATGACTACACCTCGACTGCTGCGGCACTAAAAGAATTATCCCA
GCGCGGTGATCAAGGGGCTACATCGTCTCACCTATCGCCGTTCCTGGCTTCGCTTTCTAATGCTTCCCCAAGAGTTAATGAAGGAGTTCGGCGTCACACT
CGTGACGGTAGACGTCGAGCATCAAACCAGACGGACAGTTTTTTTGACAATGCGAAGGCGGCCATAAGTGATTTCCTCTTTGGGACACCAACGAAGCAAA
AGCGAAAGCAAAAGCGAAGGCGTCGCCGAACACGTCGAGCATCAAGGACTTCTTCAGCGTTTAGCGAGACCCCGATGTATTCATCAGTTGCCACTGATGC
CGAATATGCCGATAAGTTCACATCCGACGAAGAGTCACTGTACGACGTTGGGATGGAGGCTGACGACAAAGCTGTCCACACACCCGAGTACGGGTCTCTC
GGAGGAAGCTTGCATGGAAGCAAAGGCCACTGCCAGAGTGGATCAACCTCGCAGAAGATAGCACTTGTAATTGACGGGCAAGCTCTTGAGTTTGCTCTAC
GCCCTCAACTGCGTAGCCTGCTGTACCAAGTTACTCGGCAGTGCGCCTCAGCAGTCATTTGCTGCCGCGTGTCTCCCAAGCAGAAGGCTGATATCGTCGA
GTTTGTTCGCGAATTCGAGCCCGAGAGCGTGACACTTGCAATCGGAGATGGAGCGAATGACGTAGCGATGATCCAGGCAGCACATATCGGTGTGGGCATT
TCTGGTCAGGAAGGAACACAGGCCGTGAACGCCTCAGACTATGCACTGGCGCAATTTCGCTTCCTTCAGCGGCTTCTGTTTGTGCACGGTCGGTGGGCTT
ACCGCCGGGTGGCCAAACTCATGAGCTACATGCTCTACAAGAACGTGACTTATGTGCTCACCACCTTTTGGTTTGGATGCTTCTGTGGGTTCTCTGGCCA
GCCACTTATTCTGGACGTAGCTGCCCAAAGTTTCAACGTGCTTTACACGAGTGTGCCATTGGTGCTCTTTGCCGTGTTTGACCAAGACGTATCCTCCACA
AGTGCCTCCAAATTCCCGTACCTGTATGCACTCGGTCAGAAGAATGTTTTGCTGGCTCGTCGCGTGTTTTGGCCTTGGATATTCAACGGTATATGGCACT
CAAtcgtgatcttcttcgtTTCTGCTTGGGCATTTGAAGGCTTCGGTCTAAGCATCGGTGACTTTCCGGTCATTGCTACCGAGACGGGAAAAAGTGGTGG
GCTCGTCACTTTGGGATTTGTGGTGTTCACGAATCTTGTGATCGTCGTGAACCTCAAGCTGTGCCTCGAGACGTTCATGCTTACGTGGCAATTCCTGCTC
ACAGTAACCGTGTCGATACTATTGTGGTTCGCCGTTGGCTTCCTCATCTCGCTGCCAAACAGTGGGTTCACACAAGCCACTGGCGAGATGGAGTACCTTC
AAGAGCTGCCAACCTTCTGGCTTGTGTGCCTCCTTGTGCTCTCGTTAAGCCTTTTGCGTGACGGTCTGTGGAAAATCGTGCGCCGGTTTTCACTGCCCTC
CATGTACCACATTCTCCAGGAACGCGAATTGATGGGTTTGCCGAACTCGCCTCGCGGCATGCTGCGCGAGCATCGTCGATCTATGCTAAGTACGGCGTGG
TCTGATGCGCCAGCTACAGTTGTGAACTACGCTAGGCTTTTCAGCAACATGCCGCGGGTGGAAAGCCCCGAAGAAACGCTCatgcgttcttcttcgcttg
GCGAGAGGTTAATCGCGTCTCCTTTCTCCGGTTCATCCAGCGGTGGGGACACCATTGACCCAGATCATACAGCAGGATTTCAAGTCCGAGAGAAGAAGCG
TAATATTCGCATTCGTGGATCATTTCATGCCACaggcagcagtgacagcttTGGCGCAGGTGTGGAGCCATCCTTCCTGGAAGCCCCTgggtctgttgct
gctacagtCACAGCCAATGCAGCAGTCGGATCTCGTTCGTCATCTTTCATTGCAGCTCCTGGGGGTTCGTATCATGGCTACGCATTTtcggaggacgaga
acgtGGACAGTGACGTGGAGGCAGCGTCCTCTAGCACAACCCGAGTCGACCTCGACCAAGCGAAGTCAGCATTTGGAGCACATGCATCGATCAAGAAGGT
TCTCAAGTCGGTTCGTGGTAGAAAGAATGCATAAGTGTTTTCAATGTACAGATCATGACTCCGTGAGGCATGAAGACAACGTTGTCTGTGTGATGATGTC
AACCTTTTCAACGAGCAACAAGTGGGGTGCTGTATGCTGACTGTATCGAGAGCACTCGAGAGCCTCGTGAACGGCATGAAGGTATCTGCGCTCACTGTAG
GAGCGGCGAGGGATGATCACAGACTGGCTGTGATTCTCAACGCCACAGCGATACGGCCGCGCGATTCGCACAGACTGGAAGTGGTCGCTAACAACTTGTC
GGTAAGGTCGAGCATACAGCACTCGCTCaggtggagacggtggagtTGAAGCCGACATAACCCCTGGGTTGAAAGTTGAAGGTAGTGGAGCTTTCGGTAG
TTCTGTTGTCGCTCGTAACAGAAGAATGCAATTGAACGTGTGCTCCTACACAAGGGAGTGAGCGGAGAATGAGCGCCATGAAACGAAACACAAATTGCAT
CGATCGTTTCCTTACCTGCTCCCAGCGACTATCACCGTCGTCATATTCGATCTGCAGGGCGGCAGGTGAGGCTTGGACGGCACTGACGACGCCATGGTAC
CATTCAGCTTCGTCGGGCCAGTAAACCATCGCCCTTCGGCCTACGATTGCTCGGGTACCTTGTTTACTAAGTGgcaggagttgctgcagttgatcATACT
GGCTTGTACCAGTGACTGTAGCGGGGAGCGGACGGATATTTGATTGATCCTACAGAATTGACCACCATTTTCAACCACTGTTCTTGCAGCAGGTCAGTCA
CGTACCAACTTACCTCCCACTGCtgctctccatcgtcgtaGTGCACGCAGTAGCGCGGTTCATTGCCCGCCTCGACGCTTTGAATGTCCCCGTCGAACCA
CTCGTTCTCCTCTCTCCAGAAGGCCTGCACGCGCGCCccgacatgctgcagcatggaagctgcagcagctgatgcCTCCGGTTCGGCAGCATCATTGTCC
GACTCGAACGAGTCCGAGTATTCGTCGAAgtcatcctcgtcgtacTGCTCGGAGGTGACAGCAGAGGCGGAGACAACGGAGGCGGAGGCCTCGAAGTCGG
TACTGCactcgctgttgctgaccATCTCGCTGGCCTGGCAGAACCCGGCGTCCTCTTGAGTGGCTGCTTTACATATTCATCGTTGGTTACGGAAACTGCC
AGCAACAAGCAACGCCCCCGATCAGAGATGACAGTGCAAGCGATTGCGCTGTTGCGTCCCGCCGGTCTATTATTGCTCTCGAAGCGACATACCTACCTGT
ATGTAGCCATCTGTTCATATCGGCGACCGTGACGCGTCACGCGCAGCACACTCCATTCAGCCACGTCTTGCttgacaacttcaacgtgttgCCTTGATGC
ACTTTTTGGCACAGCGCTCGGATACGCTCACGAGTTTGGATGGGCGCGCGCGGGTGGACCGGACGAGGGGATACAGCCAGTCCAAACCTGCATCTCGCGA
ACTCCAATGTGTCCGGAACGCGCGGTGCCGGCTCGAGGCACTTACAtttcgacagcagcgctgctgtggcaGTGCTCACCACCGTTTCTGAAGAAGTTTC
GTCGACTTCGCCGATCGGAGACTTTGGTCGTGGTGGGTGGACCTAGAGGAGGTCTTATCCACCGATGGTGGACCGCCATATGCAGGCTTTTGTACCGCGC
CATAGGAGTCCTATGATAGGACCAACTGCAACTGCATGCACTGCTGCCGCGCGGTCGAGTTCGTCCAAGCGGCAAGCGGCTATGCTGCCGtctgccgtcg
ctgtcggcgTTTCGTGTGGGTCGGAAGGGAGTCGTCCAGTTGCGGGCGCTGAATCTCGCGGATAAACAAATTTAAGACGAATCTCCGGCACGTCCCATCC
GCGCCTGCAAGCCGCACCATTTTTTCATTTTCGCAGCCGGCCACCTCTATCCTAGTTTGAGCCTGGCAATTTGCACTCCTCCACCCCCGCCGCCGGCTAG
AGGGTATCAATAATGATCCGCCAAGCAGCGAACATTCTCAGCGAAGACGGTACTGTACGGTTCGTAGGCG