Description :
From Genome Similarity Track
Location :
Scaffold_437:13153- 14902
Transcript NameFunction/comments
Phyta_totarag8285hypothetical protein PHYSODRAFT_496426
Phyta_totarag8286mitochondrial inner membrane protein OXA1

Sequence
1749 bases(100 bases per row)
TCGagcagaaggtggtgcaggagCAATTGGACATTGACTGCCTGAATTTCCAGTTTCTGTGTTCGAGCGCCAGCGCAAACGGCCCCAGCGACTTCAAGTC
CACGCTGCTTTTCCGAAACGATGTACACGGTCTGATTTTCGAGCTGAATGTGGACTTGGCTCGACTGGCGCTGCGGCACGCGGCCACACTGCCAGCGTTC
GGCTTCGTGCAGGCGTCGAAGCAGGAGAAAAAGTTCATGTCGTTCCATCCGTCAGGTTCATTCGCTTGCATTGGCGAATTCGAGCGGCGTGTGTTCGTGT
ACCAAGGCAGCAGTTTGGAAgaggagcgcaagctgcacaCGCGCAAGCAGCATGTGGTGGAGCTcggcgaccagcagcttttgGGGTTGCAGATTGTCAA
CGATGATACCATCCTCGTGCTGACTTCAAGCCAGGTTTACTCGCTTGAGCTGCCCGAGCAGTGTTGACACCAACACGGAATTAATTCATAGcgcgcttca
agttgaaggacACCATCGGAACGTATGTTTTCGTCCAGTAATATCGATTCATGAGCTTAAAATCAACCAATCCCGTAGCAGGAACTCTTTCAGCGCAGGC
CACACAAAAGGCAAAACACCACTTGCTCACGAAGTGATGGTGTTCCTCTCGATGCGTCGAATGCAGCCGGCTGCCATGGCCATGGCGCGCTCCTCAGCCC
GCAGGTGCGTGGAGAATATGCACCCCCTTTCGATATTTACTATGCTCATTTAATTTCTCGTCGATATGCTGATTGTTCGTTGTTCTGTGTGTCTCTTACT
ATGTGTGTCGTCCGTAACCAGCGGCCCTCGTGTTGCCCAGGCCAGACGcacgctgcgcttcgagcACGCAACCCAACTGGGTGCCGTGCAGCTCATCCCC
ACGCACAGTTTCGGTGGTCGGTCGTTCTCCTCCACACCGGTGACGGGGTACGAAGCTCTTGCTATTGACACAGATGGAGCTATTTGTTGAGACTGATGGC
GTTTGGGGGAACTGTTGCATTGCAGAGCGCTTGACAGCGAccgggttgttgcagcgtcGCCTtcggaggcgctggaagctgcggGTGCGATGCTGCCATG
CTTCGCGTGATGTGCGCAAGAAGTCTAATGTTGTTGTAATGTGTGATGCTTCATGTTTCTTGGTTACAGGCTCTGTCGATTACGCCTCCCTTGCCGACCT
TGGTGAGCAGCAGTGTTTCGGAGTAGGGGGTGATTACTGGACTAATATACTGACAATTGCGTTTTTCCATTCGGATTTACAGGCTACGGACTGTCAGATA
TCGCAATTCGATCGCTAGATGTGATTCACGCCACGACGGGTCTTCCGTGGTGGGCAACTATCATTGCGACGACAGTTGCCGTGCGTACGGCCTTCTTCCC
GATCACGGTCATTTCGGTAGGTGGATGGCATTGGCTGGGTTCCGTACGTGTGTACTTATCGTTGCTGGGATTTTTTATGGCTTAGATGAGAAATGCGGCC
AAGATGAAATTGTTCCAGCCGGACATGGAGAAATTGCGCGACGAGATGGATGCTAACCCGACGCGAGACGGCGAGTCCGCGCAGGAGTTccagaagaagt
acaaggcgttgatgaagaagcacaacGTGAACCCGTTTAAGAGCATGCTCACGCCATTGGCACAGGTGCGAAATGGTGTTTGTTGTCTGACCCATTAAAA
AAGTATGTGCTAACTAACACTGCTAATCTTTGTGTCTTGTATGGTAACG