Description :
From Genome Similarity Track
Location :
Scaffold_12:131528- 134757
Sequence
3229 bases(100 bases per row)
TCCTCCCACACTCAAAGTAGACACACCGGTGTCAGTGGGAAGACGGGGGTGACGCAGATGGTTTGCGTAAAACGGGGAAACCCCATGGAGGCGTGGATCG
AGGAATTGTAAGCAAATACCACTTGGTGGAGTAGGGAACTCCACGTGCGAGATTTCGACGCAGCATAACTGCGGAGCACATCTTCGACAACGCGGTTAGC
GCTATCGGTCTGACCGTCAAGTCTCGGGGTGGTCGGCCGAGGACATGTTGAGGCGAGTGCTAATGCGGGCAAACAAAAACTTCCAGAAAGCGGAAGTGAA
ACGTGGGTCTCGATCGGAGACGATGGAAGTAGGGAGGCCAAAGCGACAATAAATATTGTCGAAGAAGAGCGCGGCACAGCGCTCAGCTGTGATGCTCGCC
CTGACGGCGACTGCCACAAGGTACTTCGACCCCCGGTCGACGCATACCCAAATGCCCGTGTTGCCGCGTTGGTCGCGGGGAAGGCCAAAGATGAAGTCCA
TACTGACGGACTCCCAGAGTTCGCTGGGAACTTCCAAGCTCTGGAGTGGAGCCTGGGTGGACGCGACGGCCTTGATTGATTGACAGACGTCGCAGGAGGC
GACGTAGCGAGCAACGTGTTTATACAAACGCGGCCACCAAAAGAGGCGAGCGACGGTAGTGTACGTTCGATCGCGGCCGAAGTGGCCCCCGCTTGGGGTA
TCGTGGAGCTCGTGCAGGATGTCCTGCCATAGAGAATAGTCAATCGGTCGTGTTGGTGGAATACAGCAACAGACCGTCGCGAACCGAATAGCGGTCGAGT
TGGGGAATGCGAGAAGGTATCGCTACACCATCATGGAGGTGGGTGATGATCGGATCCAAAGCGGGGTCCGTTGTGTAAGCTGCTCGGATGCGAGCCAAGA
GTTCCGAGTGGACCGTGGAGATGGAGGAGAGCTCCATGTCGTCTGCCGACGGGAGTCGGGACCAAGCATCCGCGACAACGTTGCCGCGGCCAGGCTTGGA
TTCAACCTTCATGTTGAATTCCGAAAAGAAAGAGAGCCAGCGCTGCATGCGCTGGGACAGATGCGGTGAGTGGACGGCCGTGCGTAGCGATGCGTGGTCA
GTGAAGACCACGAGTTCCTCCGAACCCAGGAGGTAGATACGAAACTTCTTGAGCGCGTAGTACATCGCCAGAAGCTCCAAGTCATGATAGTTATTCTCGG
ACTTGTGGAGCTGGCGGGATTGGAACGATACCGGGCGATCGCGCCCCGAATCGTCGCGCTGCATTAGGCAGCAACCGATGGCGCGGATGCGTCGCAGACC
ACGAAGAAAGGTCTGGAAAAGTCTGGCAGAGCCAGAACTGGGGCCATGGTGAGGCTCGCCTTGACGGCCTCGAAGGCCACTGGGCACTCTTGGGAGCATA
CCCAAGGAACGTCCTTGCCAAGTAAGCGTGTCATCGGGCATGCCAGGTCTGCGAAATTCGCCGAGTACTTGTGCAGATAGGTGGCGAGTCCCATCCAACT
GCGCAGTTCGGGGACTGAGCTTGGCGATGGCCAAGCTTTGATTACGGTCACCTTGGCCGGGTCCGCCCGGCAGCCGTTGATGCCAACGAAGTCGCCGAGG
ACAGGAATCTCGGGTACCCCGAAGAGGCACTTCGACAGGTTCGCATATAGACCGGTGTCTCGCAGTGTCTCAAACACCAAACGTAGGTGTGACCGGTGGA
CATCCACGTCGGATTGCGACGAACTGGCACGGCTGTGGATGTAGACGTCGTCGAAATACGACGGAGCAAATTCGCGAAATGGACGGAGTTTCTCCGTGAC
GACGCAATTGAAAGTAGCAGGGGCGTTCTTGGGCCCCTGGGGCATCACCAGCCATTCCCAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNCATCACCA