Description :
From Genome Similarity Track
Location :
Scaffold_81:13152- 14495
Transcript NameFunction/comments
Aphas_H257_16088Hypothetical protein

Sequence
1343 bases(100 bases per row)
CAGCCCCAATGGGGTCTGCCCCCCCAACCAAGAGGCTCCCATGACTAACCCAGGATGCCCCGTACCTTGTTCTTTGAACATGAGCCCAGCCCCATGGCGG
ACTCACTCTCCAATCACCCTGATCCATCCAGTGCGACTCCAGATGAGGAATCCCTTCCCATGGATGTTGATGACTTCACCACTCCTAAACGTACTGCCAA
ACGTAAGGACCGTGAGTGAGACCACGTTGACACTGGCAACCTGGGTAACTCCAAATTTCTTCGACGACCTTCATTCCTTCTCCGACCTTGCATCGTGGCA
TGTCGACAATGGAACTATACCAAGCCAATCACTATGTATTGTGTGGCCGTGCGGAAGGTGGATTGTTCCACCGTCTCTGACTCCCTCGTCAAACGAATGC
ACGTCAAAACTAAGCGATTGGAGTTGCACCAGTTTCCAAAGTCATGTTGTTTTACACAGTTGATAACATCAAGTAAGGTGTACTAGTAGTCGTCTTCGGT
GTTAGAGACACCAGATGGATTTTATTTATCTCAATAGCATCAAGAAACTACTCATAGCATCAAGAAACTACTCATGGAAATCTAAGCCACTCAGAGCACA
AATTGAATTCTGGACATTCGACCCGATTACGGGAAAGTTCCGATTAACCGAATGAATTAAATGGTTCAAGTGAGGTACTGATCTATACAAGGAGTATCTT
TATCCGGAAGATTATCCGTATTTTAATTTCCCCCAGAACAGGTATATTTCGGCTCCCTAGCACGGGTTATACCCCTCCTGGGGGGAATTCTTCGACCGAC
GTTAATGAATAGAGCACAAAATGTTATCCAATCAACAATACTTTGCTGAGAGGTCAGTCCTAATACTGACAATACTTCTGTGATGCCTGCACTGATATTG
ACAGTAGGTAAACCATCAATATCACGAACGCTTTTTGTGCACTAAAATGCCATATGTTTGAAGCACTTCAACTCAAAAAGTCCATCGATTAAAGAAAACT
AAGGATAGCGTTGGAAAATATAAATGCAGCTGCATTTTTTAATGCCAAGAAGTGTCTGAAATAGAGCTCTTTCGAAAACCTGCTGAGCTAGAGTTTGAGT
TTCGCCATGTGGTTCCCAGTGATTTGATTGACCAATGCAAAAATACTGTATTTGAAACGCAAATCCAGTTGACACAAGTCGGTCGATGTCTCAACGACTA
TTTGAATTAGAGTTTCGCTGGAGTCAGGTGTGACACATGGCGCGTCATGGTCATATTCATATTATAACCAATCAAACTACAGAACTCCAGCACGTGGAAA
AAATATAGATCCGCAAACAGCTACCGTACCTTGCAAAGCTATG