Description :
From Genome Similarity Track
Location :
Scaffold_62:131473- 135195
Transcript NameFunction/comments
Sapdi_VS20SDRG_13658hypothetical protein
Sapdi_VS20SDRG_13659hypothetical protein

Sequence
3722 bases(100 bases per row)
TCGGCGTATCCGACGCGATGAGCCGCCGGCAGATCCGATTCGAAGAATACGCATCGTCCGGACCCGTCGTCGAGCGCGTCGCCTGCAACATGGAGACGAA
GCCAGCGCGGGCACCCAAGTTTGCTGCTTCTGCGTCGCACGTCGCCAACGACGCGTACCTGGCGGCCTTTGACGCCGACCCGCGAAAGCCGTCGTCCAAG
CAGCCGCAGCCAGCAAGCATGAGTACCTCGGGAGATGGCAACACTGCTTTGCCCAAGATTGCTGGCGCCGTGCGCGCACATGTGCCCGCGGCCGAACCAA
CGACCCGTTCATCGTCGTGGACGCGAGGTCCGAGTGATGCTGCTGGCTCGGCGCAAGCCGTATCCAGCCAACCGCTGACTTGCATGAGCTTGTCGCCGGA
TGGCTCGGAAGTGGTTGTCGGCAGCTGCGACCACGCGCTCTACACGATCCCGCTGCGCAGCTCGGGGTCCAAGAAGGCTCGGGGACTCACGTTGTACACC
ACGACGTGCGGCCACAAGGAATGGGTCACGGCCGTCGCGCACCTTGCCGGTACTGACAGCATTACGAAGTGCCAAAGCGCATGCACATGTAGATGGCCGC
GTCGTCTCTGCGGGCATGGACAGCAAACTCTGCCTCTGGGAGAACGGTGCCGTCGCACGCTGCGAAGACCTGGTGGGCTCTCGAGCCCCACCGTCTCTCG
ACTATTCAATGTATTAGATGGGCCACGCCGGGTCCATCTCGCTGATCCAGACGATTGGCAACGACTGGATCGTGAGCGCGAGCTACGACAAGACGTATCG
GCTGTGGGACGCGACGCCCGGGCGCCGCGCCGGCAAGAATGGCCGAGAGAGACATGCGTTGCGCGGCCATGACGCCCCGATTCTCGACTGCAGCCTCTGG
GGCTCACGGCTCATTGGCGGCGATCGCAGCGGCTCGGTGCTCGTTTTCGACGTCGCTGCCTGTACGAGTTGATCGTCAGTCGTCCTCTTGACGTAGCACG
ACGCTTAGATACTCTCGAGAAGAAGTGGAACGCGGCGCACGACGGCCACTGCACGAGTGTTTTGGGCTCGGCGTTTGCACCCGACATTGCGTACAGTGGC
GGCCAAGACGGCGTTGTGCAGCGCTGGGACCTGCGCACAAAGGCGAGCACGCTTGCGCTGCCCGTGCATAGCGGCAAGACAGGCAAAGGCGCCGTACGCT
CTCATAAATCATCGGCCAAAAGCTCAGAGACGACTTTAGGTGAGTTTTCTACGCGAGCAGCCGTCAAACGAACACGTTCTTGTCACGGGGGGTGCTGACG
GCAAGGTCCACGTCCTCGACACGCGCCGCAACACGCTCCGGTCGACGTTTGACAGCCACCAGACGTTCATCTATTCGCTGCATGTGGCCCACGACCTGTG
CTTTAGCGGCAGCGGAGACGGGATGCTGCTCGTGCACAACTTGGCCACCGACGCCTTGTGCTACGGCCTCGGCGCCAACCAAGCGGCGGTGCGGGCCATT
GCCACGACGCCCGCTGAGCTCGTTGCGGCCGGTGACGATGGCGGCGTCCTTGTCTATAACTTTGCGTAAAGTTATGAATCTACTGGATGGTGTCGATGTG
GCGACCTTCTGTGCTCTCGTGAAGGACAAAGCTCTGTGTACCGGACGGGGGGCATCCGAAGGTACATCAGGCCCAGGCACCAACTGGGATCATCTGCGTA
AGGACTGCGTGTGATACCGAGGCCAGTTCGTGCTTGACAAGATGCCATTTGTTGGAGTGCTCACCAGTGGTATTAGCAATAAGTTAGTGTTCTATTACGA
AATCGACGAGTTTGTACTTAGCCCAAGGTGCGGGCAATGTTGAGGACGCTCGCAAAGAGCGCGCTGGCCGCGAGCCCTTGCGTCGCATCCGACGCGAACG
ACGAGCCCGAGAGGAAGAGTGGGAACGCTGCGTGGCGGTCCGTGTGCAGCGCGAGGCCGACCTGGGCGCCGACCAAATGAGCAAATGGCGCCGACGACGA
CTGCAGTTGAATCTCAATGCGACCGTTTGCAAGCGTCGTCGTTGTGCGGGCGGCCTTGGGCAGCTGCGCAAACGCCGGCGCACAGCTTGCGACGTGCGCA
ATCACTTGGTCGATCGTCGTCACCGCCGTCGGGCACGGCGAGACCGGCGACCCGTTGATGGCGTCGGCGGCGTTCAGGTTGAGGCCGAGCTCGCGCGCGA
GGAGCACCATCTTCTTGGCCGACGCGACGCCCGTGAGGTCGTCGAGCACCTCGGCAGGCGCCATTGACGAAAACTGCGCCAAGAGCACGCTGCGAAGCGC
CGCCTCGATGGGCGTCGCCGGCGCTTGGTCGAGCTCGAGGAGCAGCGCGTTCATGACCGAGCTCCACGAAGCCTCAATCTTGGTGATGCTGTCGCCGGTC
TGGAGAAGGTTCTGCAGCGTCGAGAGAACGGGCACACCCATCCCGAGGCAGGCCTCCGTGTCCAAGACGACTTGGTTCTGGGAGGCCGTCTTGCGCAGCG
AGAGGGATGCATCGTTGGCGACGTGGAGGTTGTTGCTCACAATGAAGCAGTCGGCGGCCAGCCAGCTCGGGTACTGCTTGATCGTCGCGTCGTCGCCCGA
GACGTCCAAAACGAGCGCATACGGAATGTGGTCCGTATGCACGTGTTGAATGAAGCGGGCCATGTTAAGCGGCTCGGACGTGGCCGACGCGAGCGACGCT
GCGTTGAAGCCCGTCGGGTGCAGCTGCATGTGGTCGCGGTCGGCCACCGCGCGAATGCGCAAGTCGACCTTGTACTTGCGCGCTAGCATGGCGGCTTGCG
AGAGGATCTGCGTCTGGAGCGCGGCGCCGACCTTGGAATGCGCGCCAAGAATACCGATCGAAATGGTTTGGTCCGCAAGGAAGAACGCCGAGTGCACCGC
CCGAAGCGCGGCGCCAGAGTCCTCGTAGCGCACGACCGCCGAGATGTTGCGCTCCGACGAGCCCTGGGAGATGCCGAGGATGTTGATGTCGGCGCGGCCA
AGAGCGCCAAAGAAGCGCCCGCAGACACCGGGGGTTTGCGACATGTTGTCGCCGACGGCCGCGATGATGCTTACGGGCGACTCGAACGTCACGGCGTCAA
TGAGCCCGTGGTGGAGCTCCTTGAAAAAGGCGGCTTCGATCGCGTCCTTGGCGTCAACCGCGTTGGCCGCGGGGATCGCAAAGCAGATCGAGTGCTCGGA
ACTGGCCTGCGCAATGAGCACGACGTTGACCTTGATGCGGTCGAGGGCCGAGAAGAGGCGGGACGCGACGCCGTGGACGCCCACCATGCCAGTGCCCTCG
AGGTTGAACATGGCGAGGTGATCGATCGTCGAGAAGCCGCTCACAATGTGCTTGGCGGTCGTCGTCGGCGACGTCGGCCGCCGATGAAAAATGCGCGTGC
CCGGGTGCGTCGGGTCGAACGTATTCCGGATAAAGATCGGGATGCTCTCGGCGACGGCCGGGGCCATCGTCTTGGGGTGGATGACCTTGGCACCAAAGTA
GGCCAGCTCCATGGCCTCCTGGTACGAGATCTGCGGGAGGATCTTGGCTTCCGGTACGCGGCGCGGGTCGGCGCTGTACACGCCGCTGACGTCGGTCCAG
ATGGTAATGGACGCGGCCTTGAGCACGCGGCCGAAAATGGATGCTGAGAAGTCGCTGCCGTCCCGCTTGAGCGTCGTGACAACGCCGTCGGTCGTCGAAC
AGATGAAGCCCGTGATGCAGAG