Description :
From Genome Similarity Track
Location :
scaffold_267:13140- 15626
Transcript NameFunction/comments
g6529.t1 conserved hypothetical protein

Sequence
2486 bases(100 bases per row)
TCCTTTAGAAGGCTCTTGTTCCGGAAGGCGACACGCTTCACGAACTCGGTCTGGGAACTCTTCGGTATCAGAGTTTTCAATGCGCTGCGTGTACGTTGAA
GCGCAACGGAGACGATCGAGTTTGTCAGTGTCGGGTGCGACGACGGGGGCAGGAATGGAGGAACTGCTGCACTCACACGCTCCTCTCCCAGTTGAAGGGC
TTCCTGTAAAGCTACCACAACGGTGGAATTCGCCTCGTGGTGGGTCTTGGAGGTTAAAAGCACTTGGAACGATGCGCGGGCGGCAAATGCAGCGTCTTGG
CCTAGAGACGAAGTTGAGGTTAGTCCGCACTCCGATGCACACCGTCCAACAAGAAGATCAGCCCGCGGAGAGACTACGCGAGCTATGACGTGCTCACACA
CATCCGTCGTCACAGTCCCAACCACGAACTCCACCACCGCCTTCAACTTGGGGTGTACCTTGAACACAGCTTCGGAAAGTTTATCGTTCTCCTCCTGTAC
TGGCGGGAAGTTGAAGGGGGAACCGGTGGATACTTTTACTCCTGAACTGGCACCGGGAACTGAATCCTGATGTACAGTAAACGAGGCGACACTTCGGTCA
TCCTCAATCACGACTTGCAATGGCCGAAGCTTGCGGATTGGCGTCACTGGCTGTCCTGCCGCCACCAATCCGGAGCCAATAGAAAGTTTCCTGCGAGGTG
TCGGCTGCGCGCGGGTCTGAAGAAAGCCACGCAGATCGTCGAGCTCACTCACGCAGCTCTGGACGAACACTTGACTGTAGAGAAACGGCAGCTGGTCTTC
TCCAGAAGCTGCCTGTTCATCCGCAAGAGATTCACGAATCTCTACCGAGGGGAGCAAGTCGTTCGACTGGTATTCACTACCGTGAAAGGAGCCGCCTTCC
AGGCGCAACACGCGAAAGATCCGCTCGATCTGCATCGCGATGTAAAGCCCTGTCTCGCCCAAAGAGTTCAAACGCTGTGAACGGTACAGAAGCTCAAGCA
AGACCACTAGCTCCTTGAAGTACGTCGTCCCCATCGATAGTCTATCGAGCGACAGCATGGAGAGATAGTCGCACAGCCACGGAATGCACTTGGAGACGGA
AGAGTGAAGGATGCTGGCTTCCAGCAACTGCTTGACGTCCAGACTGGAATCGCGAGCGACTTCCAGTGTGTTGATCCCTTCTCGTTCTACAGCCTTGAAC
GCAGCATTGTGGGCGGATAGGCCGCGGATGGAGGACGTCACTTGCCACTGAGGGGAGAAGCGGAGGTACCCGAGGAATTTGGCCACCACTTTAAGTCTCA
ACACGACTTCCGTGAAATCCTTGCGAGCGTCAGTAGAGGGAGAGATTGTGTCTCGAATAGCGTAGAATTGTCGCTCCAATTGGTGCTTGACTAACTCGGA
GAACTCGTAACTGTCACAGCTGTGCAGGAAGTGAAAGAAGAAGAGCTGGTTGTCCGTAAAGTAAGCCTTCATGCGGTCGAGAGTAGCTGTGAACTTCTTG
GTTGCGTCGTCCTCGCTCGTAGTCTTGACTGGTTGTCGGTTTTTACGCACCGAACTGTTGTTTCCTTTGCCATTGGCCCTGTTCCCACTGGTAGAAACAC
CGTTGTGTGGCTGTGGAGCTTTGGTCGACGGCTTTTGACTCGAAAAACGTCGATGCAGCTTCAGCAAGCGATCCGGTTTGTCCTTCATGATCTTCAACAC
CAGATCTTTGTCGCTCTCGCCAAAAGGATTCGATCCAACTTGGACCAGCTCCTGCACGAAGAACTTAGCGAACCACCACCTGTTCTCCGGCGACACCTCT
GCTAGCAGCTCCCGGGCCGCAGCAATGGCTGCCGCCGCCACACCGGCATTCTCAATACCCACCAGACTGTGTTGTTTCTGCTGGAACTCCCTTAGCAAGC
TCAAAAACCCGTCTCGAACCTTCTCACGGTTGGTATACAGGAGAGACTCGACAGGCGTCCGGTAGTGCAAGCGGGAGTCCGTTTCTTCGTTGAATGGGAG
GGTAAAATCTCGCACAGCGCTTGCTTTCATCTCGACCGGCAACTGACAACCAATACGGGCGCTTTCAGCCACACGGAGCTCCTCACGTCGACGAGACTCG
TAATCCAGTCGCTCCAGCATGTCCTGGCAGATTCCCTCGGCATCGCGAAAGCTGTGTTTCACTAGTTCCAGCAGATCTGCGCCCAGACAAGCGAGCACCG
ATTCAATCTCGTTAAACACAATTTCAGCAAAGTCGAGGCAGTGAGAGCGCCAACAAAACTCCGACCTCGCCCCACACGGAGATTCCGAAGGCTTTTTACT
GGAAGATTCCGGCCGAGAATCACTTTGGCTGCAAGATTTACAATCCGCTCGGTACAGTAAGCTGATGAGGACCTGCAACTCCGTGCACGTGTTCTTGACA
AACCGCTCCTTGATCAAGAATCCGTACAACTTGGCTGCCTGCTTGTTTATCTGAAAGTCAGCCGAATTCGTTCTCTTTTCAGCATT