Description :
From Genome Similarity Track
Location :
Scaffold_398:1314- 6342
Sequence
5028 bases(100 bases per row)
CGCTTGGAGGTTCTTGAGCGTGGCGGTTGTATTTACCCGAGGAAGAGACCTCGTGGAGATGGTACGGGCGGATACGACCTACATAAAACGTAGGATGCGT
ACACATCCTGCGATGCAACTCGATTGTGTACGCATTGCCTTTGCGACGTAGTACACGGAACGGGCCGATGTTCTCGGGTCGTAGGTTACTACTATCCGCA
TTAGTTACTGCGTGCTTAGGTAGATTTACCGTAGACATTAGAACTAAGTCTCCGACATTAAATAGAAGAACGTTTGCTCTTCCGTGTTTGTCAGCGTTCC
GTTTCTGCCGGTCCATCGCTTTAGTGATGGAGTCTTGTACGAAGCGGACCACTGCTTCTCTTGATAGCAGGAAATCTTCTGCTGCATCAATTTGGTCTGT
TGCAGTGCGCCTTGTGCACACCTCTAGGAGGTTATCCTCTTCTTCAGCGAGGGTGTTCTCATCCTCGCTGGTGTAGTCATTGGCGATCATGAGCATACCA
GCATCATCATCCTCATCTGGATCAGCAATAGTGTCGTCACCATGATAAGGTTATCTTCTTCGATGTCGACTTGATAGACATCGGCAACGTTCGCGTCGTC
GAATACCTCGACGCGTGATGAGCAAGAGACAGAACGGTTGGTGCTCTAGCGAATCCCTCCCCCCTTGAATTAGTGTCACACTCTAAATGGGTGGGTAGGC
GTGGATGACGTAATCCATTCACGAAGAATGGTGTATGCGTTGTCGACGCATGCACGGAGTTATTGATCGCAAAATCCACCATCGGCAAGGATTCACTCCA
ATCTGTAAAAGATTGGACGCATCCTCGAAGTATCTCTTCGAGACGCGGTTGACGCGTTCTACATGACCATCAGTCTCGGGATGGTCAGGAGTAGACATAT
CCAGACGTTTTACGAGGGATTGGAACACAGGTTGCCAAAACATCGCCGTGAACCGTAGATCTCTATCAGAGACTAGTTCACGGGGTAGACCATGGAGTCC
GAATACCGTTTCAATGAAGACACGGGCACAACCATGTGATGAGATTGACTCATGAACTGCAGCAAGATGTACCATCTTGCTGAAACGGTCTACGAACACA
AGAATACCGTTATTCTTGCAAGCTTCTTCGAGGAAACGAAGACAAAGTCCATTGAAACGGACTGCCAGCACTCAGCCTGGATTGGGAGAGGCTGTAGGGG
TGCAAGGGATGTAGGACTAGGTTCACCCGTTGGCACACCTCGCAAGCCCGAATGTACTTGCGCACGAACTGATACTGAAGGGGCCAGTAAAGTCGCGACT
TACCGTGATATAAGTCTTCTCACGCCCACGATGCCCACCTGTTGGTGCGTCGTGACACTCATAAAGGATGCTCAATGGCAAATCGTTATGAGCGGGAATG
AAGACACGAGGAGTGCCGCCGGATTCGACTGTGTAATACAGCAACCCGTTGCGTGTTGTGTATCTATCCGCGGAATATCGATACAAGGCCGGTAAATCTT
TGAGAGATTTACAAGATGAACTCACCAGATAATCCATCAGTCGCAGAAGGGCCTTATCTTCTGCGTAGGCCTTCTTTATACTGTCAAACAGTGTAGACGA
TGGAACACTCGTGACTCGTGTTGCAACAGTGGTATCAACCTCACTGTTGGACTGCGCAGCCGACTCGAAATCGGGTCGGCGCAAAAACGCGTCCGCGACG
ACATTAAGTCGTCCGGGTTTGTACTCCACGGAGAAGTTGTAATCCGAAGAAGGATATCCACCTCGCCATCCTTCGGGAGAGGTGTGGACTGTTTACGGCC
ACGCGTAATGATGCATAGTCCGTATAGACTACGAACGGTCTATCTCCAAGGAGATAGACGCGAAACTTCGCTAGTGCATACTTCATGGCAAGGCGTTCCC
TATCATGCAATCGGTAATTGTGCTCAGCTGCTCGCAGCTGACGCGATTGATAACAGACGACGCGCTCTGCGCCGTTTGCATCGTACAGCATTAATGCGCA
CCCGATTGCGAAATCGCTAGCGTCACAGGCCACATGGAATGGTCTGTCTTGGTCTTCAATCGCCAAGATGGGCGATTGCATCAAGCTCTGCTCGATACCT
TCAAAGGAACGCTGACAATCAGCGTCCCATGACCATTTCTCGTTCTTTATCAAAAGACGAGAGAGTTGAACGGTCATTTCAGCGTAGTTGCGCGAGTACT
TGTGTAAGTACGCCGCTAGACAAAGGAACTTTCTTAGTCCTTCACGTCGACTGGCACAGGCCATTCGATAATCTCCTTGATCTTTTCAAGATCAGGGCGT
ACGCCGTGTTTACCCACGATGCACCCAAGAACTGGTATTTCGCTAGCGGCGAATATTCCTTCTTGAGGTTGGCGTACAGCTTATGCTTGCGCACAAGTGT
AAGAACCTGACGAACGTGAGTTCTATGAATCTCTACGTCCGTCTTTCCTCTCATCGCCCAGCTACGGCCGAATACTTCGTCAGCTCGGTGCGAAGTCTCG
CACCGATATCAACAGATCTGTAACACATCTGTTGAAGGTGGCAGGTGCGTTACTAAGCCCTTGTGGCATTACTAGCCACCCCCAAAGCATACCACTCGGG
GTGCTTACTGCCGTGTACGGGATGTCCCGTTCACGCATTAGGATCTGACAGAAGTCATCCATCAGATCCATCGACAAAAAGATGGTACTTTCTGACTTAC
CATCAATAATTACGTCCTTCCTCGGTATCGGCGTCTGAGCCGGTACCGTTGCGGCATTCAACTCGTTGAATGCGTGCACTATCCGCCATCCTCCTGTGGC
CTTGTGCACACAGAAGGTCGGAGAGCTGTGAGGGGGAGTTGAATCCCTCACATGACTCGCAGCTAAGCGATCGGCAAAGGACTTGTCGATCGCAAGTACT
TGTTCACGAGGTAGTGGCCACTGCTTCATGACACAGTACTTCGAGCCCGGTTTGAGCTCGATTTCATGTCGCGTGCCTTTATCCTCAGGCAATTCGCATG
GTACGGATTCAGGGAACACGTCCTTGAATTCGATCAAATCCTTATATACAGGATTTGCCTGGAGCGACTCCCAAGATCGAGACGTTTATCTCTCAATCCG
AGTCTTCTCATCGAGGACACTTTCGTCCATCGATGAGCTGCTGAGAACCCGTTCGTTCTCTGCAAATACTACTGCGGACCGAATGTTAGTCACGTATTTT
CCTCCGTGACGAGTACACATATCCGCTCGACCTTGTCACTGCGCAGATCTCGCAAGAACCGTTTCAGTTCTAGCGTTGGCAATTGAGTGATCTCCGAAGA
CGACTTCAGAGGTGCGATCAGATCAAGTGTATAAGCGCCTACACCTGACCCGTCCTTAACCAAGACATTCAATGTCTCGGTTTCTTCCTGAGAACCCTTT
TCCTCAAGTACGTGGGGACTTATTCCCTCGACGTCTTCTAGCTGTGGTTGCGCTACCACAGCTATGTCCTCTACGATCGACTCTCCAGCCGATCTAGGAT
CATCGTGTTGCCTTGTGTTAGCGACCGGTTTTTTATTACTAGGATGTCGCCCACTAGGCGTACACCCATGTCCCGATCCACTCGACTTATTCGAGTGGTG
GACCTTTGGCGCTGCCTGTGCATCCGCACAGCCGCCGGAAGATTCCTCCACAATGTGATTGGTTGTCACACTGTGACCTTGTGCAGTCTTACTAACGACC
GTACCGCAAGTGAGGCCATCGCAATCACTCGCAGTACATACATACGCTTGTGGACGCTCCAAGACGTTCATCAAATGGCCATCTGATGAACAAGTGGCAG
GCATCTTCATGGTTCGATGCTGCCAGCTAACCCTTGGCTCGTATCTTCTGAGCCAGGGTAACCCTAGGATGACATCAAATTTGGCATCCAAATCAAGTAC
GATGAAATCATCATTGTACTGCAAATCTTCTAACGTGTAGTGAAATCCCACTACACGTTTGATCAATGTTATCGATGCGTCTGTTGCGAGGCGCACCGTC
AGCCTCGTAGTAAGAGTAACGCGCTCAACGAGCTTGAGCCTACGATTTTCTAGCGACTGGCGACAAACAAAGTTGTTCGACATCCCACAGTCTACTGAGG
CACGAAGCGACAAATTTTTGTCACTTCTAAATTCAAGGTGATGAGGGGTACCTCATCATCACGTGCGGAGAAACTCAGGGATTGTGAGTCTGGAGCAAAT
TTCATCAAGAGATTTGCAATTCTATTGAGGTTGCTGGATCAGTAGGGCGCTCCGCCCCAACTGACCCCGACCGTTTTTTGATGTTCCGCCACGCTGTTGT
GACTTCGCAACAGCGTCGGACCCGCGCCCGTCGTCTTTCTTGGCGGACGTTCGATCGGTTCGCTCAGTGTTTCGTGACACCAGGTGTAGGGTACTACACT
CCTAGGCAAAGTGTCCTAGTTTCTGACAGCGACTGCATCTCTACAATTGATTGTTTTTTGAAGAGCGAGGTCTCTCGCTTTCATCATCACAGAGGTCCAA
AGGTTCTGGACCTCCGACTTCTTGTCGTCTTGGGGGAAGATATGAACCCTAACTAGCATGAGCCTGTCTCAAGCTAAAGTCTTCCTGTTCCTCAATTGAT
ATTGCTTCTTCTAGCGTATCCAGTTCAAGCGGAACAGATGGGTCTTGACGGGTCCATCTGCAAGACCCTGCATGAACACCGTAATAAACGTGTTCTCGTG
GAATGGGTTGGTCGTGATACAACTCGCAAGGATTCGTATGTGTCGGGCGTAAGCGTGCATCTCGCATACCCTGTTTAAGTTTCAGGAGATCTGATTGAGC
CCTGAACTCAGCTCGGGGCGATTCAAACGTTTGTCTGAGCCGGGTATTAAAGATCTCTAAAGACCCAAACACGTATATGTCGTGCAACTTGGGTCCTAGT
GCCCAAGTTTTGACCCGACCCGCAAAGTTCGACTGAGCAAATGCATGTCGCATTTGCTCATCAACGATGTGGCGAGCTCTTATGACGTCGTCTAACTCAA
CAAACCATCTCAACAGGGAGTCTTCCTC