Description :
From Genome Similarity Track
Location :
Scaffold_13:1314- 4954
Sequence
3640 bases(100 bases per row)
CTTCCTCCTAATCCACCATTCCCCTGTGGATTCGTCTTCTCTTTCTTTCCGATGTGACCAACTCACATCAGCGATCCTCCTCCTCCTGGCCCACACCCTT
CCTGTGGGCCCTTCTTCATCCTCCCATCGACATGACCAACTCACATCCATGGGTCCCTTCCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGTT
ACGATTCGTACGATCCCTCAAGAAATCATAGAGTAATGCTCCACAGCTCAGATCTGCCTCGTCTACCCAACTGGGCTCGTCATATCCACGCCAATGCACC
AGAAATGCGCGGTAAATTCGTCCGTATCTAGTTCGTTTCCCCGACCTCATATCGGTGATCTTCTCGACTTCGAACTCGTCGGCTTCGAGATCCACATTCC
AACTATCCTCCGGTAGGAGGACTTCGTCGAAGTCGACGCAATCGGATCCATCCACCGAAAGACGGATCTGCGGCCGATCCGGATATTCTTTGACCAACTT
CAGCTTGGATACGTGTACTACAGGGAACAGGCGATATTCGGTACCTGCCGTTTCCAGCCTTACCGCGTGTTCTCCAATCTTCTCGCTCACCCGGAACGGT
CCATGCCATAGATGGGCCAGTTTGCGGGCGTATTCTTCTTTCACTTGATCCAAATAAAGCCACACCTGCGATCCCACTTGGATTTGATGTGGACGGGCAT
CTTCGTTGTGTCGATCCGCTCGACCCTGTATCGCACTTCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCA
TCGTCTTGGATCTCGGTTTCTCTTCTTGGTGCTGCATACTGGGATGGCCGCTTCCAGGGTGGATTTGGGATCCCACCCATGTACCCAGTAAAATTGGGGT
GTCACCCCCGGAATCCTGTTCTGGGGCCGGTGTTTCCATCGCGAAGGGGAGCCGTTCTGCGTACTCATCCCAATCCCTCTGATCCCAATCCTGGACGTAC
ATCTTGAGTGCTCTCGTGATCGTCTGTACCATGCGCTCGGCCGACCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTGTCGCTGCCCCAGGATCC
GGTTGAATGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATCTCGCTAGCTCCAAATCTTCGGAAAACGCACTCCTCGTACGA
TTCGGCAATGGTCTGCGCAGTTCTAGACGCACTAGCTTTGGCTACCACGTATCCGGTAAACAGGTCCACCCAAATCAACAATTCTGTGTTTTCCTTTGAA
CGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATTTGGAAAGGGTTAGTCGCTTGGATATTCCCAGGTGACTCTCCTTCGATTGTGGGCCTGCCC
TTGCCTGTCTCACAATCCACACATTCCCCGACATACCGTTGTACGCTCTTGAATAGTCCCCTCCAGTAAAAACATTCCCGGATCCGTTGGTAGGTCCGAC
CAATACCCTGATGTCCGCCTTCCAAGCTAGCGTGATAGTGGTGTAGGACATCCTGTTGTAAGGTTTCCGGCATCACCAGTCTCATCAATCCATCCCGATC
CTCGTTGACTCTCTTCGTAGGGGGGCAATAGAAGAGCAGGTCATTCAGATCCACCGCGTAATCCGTAGCGATAATGCTGTAGGATTTGGCATCTTCCCGA
CTCAGATCCCGTACATCCCCCATCAGATACTTCTTTAGTCCTAGGATCCACGCTTCCTCGTTCTGTGCTTTGAGGATCCGCTCGATGCGGACTCTCTTCA
CAAATGTTTCCTCAAAAATTTGGGGGTTGGATCCAATCCTTCCTCTGGACCTAGTGACGGCCATCACCTGGACTGTCCTTTTCCTGGATCCCACTACCAC
CACTTCGTCTAGTCGGTTCAACGTAACGAGATCCTGATGCTCGGCCTCTCTCTCCACTTCAACACCACATTGATTCCGTAAAGCGGCGCTGGCCAAGCTA
TCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAGCCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCG
GGGCCTTGCAGTCAATCTTGCCTCGCACCTGTCTGATCACCAAATTTGAATCCCCACAAATCACCAGCCTTTTCGGATCTTGTCCCTTTAGTAGATCCAA
ACCCAGCAGTAGCCCGTTATACTCCGCTTCGTTGACGGTGAGGCCTTCCGCATAAGTGGATCTGGCCCGTACAACTTCCCATCCAGGTAGTCTCCACAGT
ATTGCACTGTACGCCCCGCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCGTCTGCCTGTACCGTCGGGATCGGGATAT
GGATCCGGTGTTTGGGCTCTTTCTTAGGAGCGATCCTGGTCAGTGCTTCATCCATCTTAGCTCGAGGTGTGATGCTCGCGGCCAAGACTCCCAGGATCTC
GTCTTTCCCTTTCGAACATTTCACAATCTCCAGTGTCCAAGGCGAGAGTAGAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTAAATAGC
CAAGCTAGCGTAGAGTGTCGAGTCTGGGTCCGGATGGATCTTCCCACCAGCAGGTTGTAATTGAGATCCAACACGCGCAAGAGCGCGAGTATCTCCTTCT
CCACCGCTCCGTAGTTCAGTTCATTTGGCTTTAGCGTCCGACTGACGAAGGTGACTGGGTGACAGATTCCTTCATGTTCTTGTACCAAGGCTGCGGAGAC
TGTCCAGCCACTGGCATACACTATCACCGTAGGGTGACGTTCCGGATCGAAATGGCGGAGGATGGGCGTATTCGCGATCCTGTTCCTTAGCTCCACGAAT
GCGTGTTGAGCTCGGATCCACCGAGGTTCCACCCTTTCCGAGTTCTGATCCGTCGTCTCTATCCTGATTGGAGCCTCTTTCCTTTGGTCCGGGGGCGGAT
CCAGCTCCTGTTTTAGGTCCTCTTCTGGCGTCGTACTACTTGGATCCCTTCGTGAATCCGACATCTCCAGGGCCAGAGCTTGTTGGATTTTGATCTGGAC
AGCTGAAGTGGTCATCGCAGCGAAATCTACCTCTCTCAATTCATATAGTACCGCGGCAAACCGGGCGTAATCCTCGATAAACCGACTGTAGTAGTTCAAA
CCGCCCAAGAAGGATTGCATCGCCCGTAACGACTGTGAGCAGGACAAGTCTCCCAACGAAGACAGGTCCTTAGGATTCGCCTTCAACCCCTCCTTGGAGA
CTCGATGACCGAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTCACCACGCGGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCAC
TCTCTCGCACAGCTGATCCCACGATTCTGCCGGGATTAGAATGTCGTCGATATAAGATCTGCGTCCTAACACAGATGGAGTCCCAGGATCCCCTGGCTCT
CCTGCTTCGAATGGGTCCACTTCCGTATAATCTTCCCCGGACCCATCCCCTTCGGGTTCCGGTATTCGGATAAATCCGCAGAGGGCATTATCGATCAGGC
GTAAATAGATCCGGGGTGCATTCTTCAATCCAAACGGCAT