Description :
From Genome Similarity Track
Location :
Scaffold_482:1314- 3760
Transcript NameFunction/comments
g9070.t1ETK87916.1 hypothetical protein L915_07707 [Phytophthora parasitica

Sequence
2446 bases(100 bases per row)
CCCATCATGTCGCGGTCCAGCTCGAAGGTTGAGGCCGCCACCATGGCAGGATCGTCCGAGCGCTCGGTCTTGAGCGCGATGTTGCTACTGTTGCTTTGGG
AGTGACTGTGGCGGTGGTAGTCCGCGTGATTGCCAGTGGCGCGGTGCATCGTGGGCTTGCTCAGGGCCGCCGCCTCTTGGATCGCGTCACTGAAGGACAT
CGAGGGCAGGCCACACGAGTACGAGGACGGCGATGCCGGAGACCAGGCCGTCTCACACCCGAATTGATCTTGTTGTTGTGACGCCCGCCGCCGATCCTCG
GTCGGCTGCGCGCGTGGCGCCGCAACGGAGTGCGATGCTTGCTCCATTGAAGAAGTGCGGCGCCAAGCGGCCCCCGTGGGAGCCTGTCCGTGTCGCAGTG
GGGAGCAGCTCATCGCTGCCACGCACCCGACGTTAAACTTTAAAGCTGGGGCTCGGGTCCGGCCGCTCTTCTTGTCTATGTGGCGAACGTGTCAAGTCCA
CGTCGGCGTCGACCGCTTTCCTGTCGGGTACGTTGGGGTACCGGACGAATCGCTAAATGAGCTAAACGAACCCTCTTCGGACCCGAGGAAAACGGGCTGG
CGCCTACGAGCCGTGAGATTGTATTTCGCCCTTGGGGGCGACGCGACACAAGTTGATACTGGCCAGCGGCATACAAACGCTGAGTCACTTGCGAGTCGAG
AAACGCACTCGCAAAGCCCAGGAAAATAGAGAGGGCGGTCGAGTACATGCACGATGCTGCTGGTCGTGGTTCCTTTTGAGTACACCGGCGAGACGCTCGG
AAGGTCTATCCGAGCGGGGTGGAAGGCAACGCGCGAGGCTGAGCGAGGAAGAAAGCTGGTGGCCCATGTGGCGGAATTCACCGGCAAAACGATACAGGAC
AGTAACAGTGGGATGTGAGATTCGATCCCAGGACCGGCAGGCCAGGCAACACAATCGGCTCGGTCCCGGTCAGCCTTGCTATCTGAGGGGAAGGGATTGC
GGTCCCAGGGAGCTACTACCTAGTTGAAGATGACTGCTGCGCTAATGTGGCGGCACTTGACACCAGTAGGGCGATCGTCATTTACATCGCTGTGGACGAT
ACTACCGTCATGGCATGTTGCAGGGCGTCTTGTAAATAAAGCACACCGGTTTTGGCGCGCCAAAGCTTAGGTACCAACTTCTGGCCTAGTAAAATGGTAA
CGTCGTATTCGACTTAACACATTTTTACAAAACCAGATTGAAACGCAAATTTGGCAGGATGGCGACAAAAATGAGCTTCGCCTCTGCTTCAGTGACCGCC
TCCACTGCGGGTAGCAAGCACTGGTGCCGAGACTCCACCACACCTGGGAAAGGTCCTGCTGTTTACCCGTTTTCCCCGCGATGTGTGAACGCCGACCAGG
CTCGAACCATGACGAACTGCGCAGATTTCAGCGAGCTTCGCTCACGAGCGTCCGACCTGATGGTGAGATCCACGTATGTACGCTCCCCGGTTCCCGCTCG
GGCCCATAGAAGCACCTGGTGAGCGGTCGTCATTGGCATCTCATTCGCGACAGCGGTCGATCGGTGAAGCGTAGACTTTTCAAAGCGCTTCATGGCCGTA
CATTCATCGAGCATCAAGCAGGATTCTAATGTGGTGCGGCCCCAAAAAATAGTGGGCTCGAGTCTATCGGCCCCGCCGCGCACTCAATGACTAACGCCCG
TTATAACCGAGCCAACTTTTGGCTTCGCGTTTATATGTCATAACCGAGACAGAGCCATCAACTTTTGACACATCGCGCCTCTTTGCATCCTTGAAGCGCG
TGACTACGTCCCCATTGCGTGTTTCTCGCACGCAGCGCGACTGTATCGCTTGGTGTACATGTAGTTCCATGCGAATTTGCACGGCGACCGTGAGGTTCCC
GATCACGTAGCTGCAAATGCTGCATCATGTACATGTAGGACACTGACAATGGTGAGGCCTACATGTAAGACCCCCTTATCAATCAGCTTGTGCTATACCA
GTACGTACTCGTCAACTAAGGCTCGCGCGGCGTTAAAAAAAATAAGACTTCAACGTCTGCGACCAAGATATGCACCTGCGACAGCCCAATCAATATGTAG
ATGTGAAGAGCTCGCGCGGTGCCAGCCTACCCAGTGGACTTCTTCCGCTGTTGGATTTCTCGTTGAGTTGGTGGCAGTGGCGCGACGGTGGCACACCACA
ATACCTTTCTCCACGTGGCAAGCTGCTCTCGCTGCCCCCCAAGCGTGCCCCTAGCAAGCAACTCAGCGGCGCTGCTCCAGACTTCAGTCTTGCAAGTCAA
GCCGACGGCCGGCGTTTACAGCAGAGCAGATACGTAGTAGTTGTGCAGTTTGCTGCTTTTGGAGGACTTATACTGTATATCGATGGCTGTTGCTCCAACA
CGGCACTCACTGGCGTACTATTCGTGTTGCTCATGCGTGTTCATTC