Description :
From Genome Similarity Track
Location :
Scaffold_755:1314- 3056
Sequence
1742 bases(100 bases per row)
GATGATATCCAAGTGGGCGTTCCAGACACCCCAAGAACTGATGATCAAGAGAAGTTGCGACAAATAGTTTGGAGGAGTCGCCATTTACTGATCGGAAAAG
GTAATGCACTGCCACCTGTGGCGCGTGGAGCAGTTTGTGATATCGATGTGGGTGGGATCAAGCCGGTTGCGCAGAGGGTCAGGCTTGTGGCTTCCAAANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNAACTGAGAGGACATAAGGATGTGTATTGATTCTAGGAGGGTGAAACAGCTGACTAGGTTGATGGTATATCCGATGACTCTGATCA
GTGAACTGTTGCGGGACATGGATAAAACTATGTGGTACTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGATTTCGCCTTTATAACACCATACG
GGTTGTTTGAGTGGTTGAGGATGCCTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCACAG
ATTTACCAATGATTGATCGATAACGCTCTGTATGGATATTTTAATATTAGCGCAAGATCCGAATCAATCACGGCCGGATCACCAGAGTTCATCGATGTCA
TCACCGATGGTGAACCAGANNNNNNNNNNTACTGATCCGGAACCATCGGTGTCCGGTCGAAGATCCTCAATTGACTACATTTTTATACCAGCTACGTCGT
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GGAAGTCTCAACTACTAGAGTCGATTTACTAAAGATTTCGCAATTTACGCATCAGTGTNNNNNNNNNNTAGAAGCTAACCTGAAATATTTGGGACCTTTG
GTGATCATCCCGTTCCCTCGGACGCTGCGATCGAGCAGTCAGTTTTGGGAAGTCTTAACGGATACGGTCAATTTTTGAAGATTTCGCAATTTACGTATCA
GTGTNNNNNNNNNNAGTGAAGCTCCAAAGTCTATAATATGATGTAAGACCTGATGACATCCGCGAAGGGGGTCAAGTATAAAAATTCGATACACCCCTAA
ACAGGAGATCGATGTCGATCGGTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNCCGATCTTGAATAATCTCGATCCCGATCGATAGTCTGTGGTCTTAGTGTATGCTTGTAAGTGGGCTGTATCAGCNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTAGATGCTAGCTATCTGTTATACTATGCTGATATCCCGCGAGATTAAGGTGCTTACGCGGCATTCGACACAGGCATGGTTGTTACAATCTTCAGGCC
GGAACAGAAGATTGGAAAGATAAGCGCTGCTTTACTATCGAACTGTCCGTTGGGAGATTCGGCAATATGAGAATGGAGAAGATGAGTTACTCGGCACATT
GCTGCGATTATAAGGCCTCGTNNNNNNNNNNGGAAGTCTCTG