Description :
From Genome Similarity Track
Location :
Scaffold_1329:1314- 3034
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1329-snap-gene-0.2Protein kinase

Sequence
1720 bases(100 bases per row)
TCACCGCAGCCTCGTGTAATCCGGATGATCTCTATGCCCTTGCAGTGTAGCCGGTTGTGGATGCGGCGGTCCATTGTTGGTGGCGCGTCTGCTCGAGGTC
ACAGTCGCCATCCAAATTCAATCGCACGCGGGTTCGAGACTTCAAGTTGCTCTGGACAAAGAGCGCGCCACGACTTGCCTTGCCAATACGGAGGTTCCCC
ATTTTTAAACTTCAAATATGCTCGCCTCAAATCTCCGGGTTGACGCGCGACTCGAGCACAAACTGCTGCGCGTAGGACTTCGTGACCTGTTGGAGCTTGT
AGAGCGCTTCGATGGCGCTCGGCCGGTTCTTGGGGTCGCTGGACACGCACGCAGACCCTAGCGCAGCGAGTTCCGGTGGACACTGCGCGGAGAACTCGAC
CTGGATCTTGCCGAGTAAGACCATCTGCAGGATGGCCGTGTCGGACAGGTCTTGACCGGCAATGCTGTGTCGAACGCCCGAGTACGGCAGCGCATGCGAG
TCGAGCTCGGACAAGACGACGCCAAAGGAGAACATGTCGGCCTTCTCGTCGTACCGCTCGCCCATCATGACCTCGGGAGCCATCCACAGCGATGTGCCGA
CGCCGACCGTCATGGTCTTGCTGCTCTGCTCGCGCGACACGCCAAAGTCCGTGAGCTTGGCCTCCAGGTTGCGGTTCAGCAGGATGTTCTTGGACTTGAG
GTCGCGGTGCAGCACGGGCACAGCGAGCGAGTGCAGGTACGTGAGTCCATGTGCCACGTGCTGCGCGATCTGGAGCTTCTCGCCATCAAAGCCCAGGTCG
TGTCCGTCTTTCTCATACTCGGCGAGCAGGGACCGCAAATCGCCATTGTTCATGAACTCCAATACCAAACAGAGATCAGTGAGCGAGTCCCAGGCCACGC
CGATGAGCTCGACGATGTTGGGGTGCTCCATGCCGGCCATCATCTTGATCTCGCCCAGGAACCCTTCGACCCGCTTGAGATCTTTCCTCGAGTCGGGCAG
CAGCATCTTGACGGCCACGGTGCGGCCGTTGAACGAGCCAGCATACACTTCGCCGTACCCGCCACGACTCAGCAACTTCTTGGTCACGACCTTCTCACGC
GAGAGTCGCACCGCGAGGATCTCGTCGTCATCCCAGAGTCGACTCGTCATGAGCTGTCCCGTGAGTCGCTCCTGCGCTTCTTCGGCATGTCGCTTGCGTC
GAAGCCAGTAGAACACAAGCGCGATGGCAGCCAGCGCCACGAGGCAACCGAGGATGATGGGAACAAGCAGCAGAGTGTCGAAGCCGCTGTCTTGTTGCCC
AGTCGAGACGTCTGCTGACTCAGAGCCACTCGAAGAAGCCGAAGGAGCCGTTGGTGCGAACTGCGCGACCCAGGCAGTGACCCACGCCGAGATCTGCGGA
CTCCCCATGCGTGCACCGAGGTCGGCGTCCAGTTCGTCCTGCGAGAAACACGGGATGGTAACCGAGCTGTACCCACCTGGCAGCAGGTCGCACTCGCCGT
AGAGCGGCGTGCTGCCCGTGCGGATCTCCATGATGCGGTACGTCGTGTCGTTGACCTTGTAGTTCGTTCCCATGATGGAGAGACCGGGGATCAGCGAGTC
GTTGCCGCCAGTGGCCCACACGGACTGTCCCGAGATGGCGCCGAGCTGCTGCGTCACGGCGATGCACTTGGCCACCGACAGCAGCTTGGTCGTCTTGCAC
GAGTCGGCCGAGTAGGCGAC