Description :
From Genome Similarity Track
Location :
Scaffold_2409:1314- 2673
Sequence
1359 bases(100 bases per row)
AGCTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCG
GGATCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCA
CTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTGGCCTTGCGGGTGT
GTTCCCTTGCCTTTGCGTTCCTTTGCGTTGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTGAGAGCCCCTAGGGTGTAACCGACCAAGTAGTAAA
TTCGGTTAACCTGTCGGATCTGCACAAGTAAAGGAAAAGCTCACTAGGTTGTAGGATCTGGCCAATGTATTATCCAGTTATCACTACCAACACTAGATTC
GCAATTCCCAACCTTCTCGGAGCTCGTACGGCCAATGTAGTTCCGGTTCTTGAGGGCAGGAAGGCACTTGCGTGTCACTGTGCAAATTGGAGTCTGTATT
GATATTTAAGCCTATACCTGCCTGGGTTTCTACCTTCTATGTCTTTCATCTGCTAAATCCTTTACCAGGCTTGGCTGCATGTCCCTTCTTCCCTTGACCC
ATCATCCCAGCTGTGTTATCTTCAGATCCACCGGATATATGACGTAATCATCATGGTCACCCTATTATGGGTACACTCATCCGGATCCAGGTCGCTTGGA
TCCACCTCACTGTAATGGTACACTCGCCGTGGATCCGAGCTCTCCAATCATCCAACATCATCTCGCAACCATCTGTGATCTCCGTTGTCCCACGAAAGTT
CGAGATCCACTGTATCCCTCATCCCTATACCCTGGATCCAGGTCCCTCCAGGCGGGATCCTCCCTCCTTGGATACGAACTCGGAGGTATGGGATCCGGGG
TACCTCGCGGTGGATCTTGACTCTTCATCAGCCGTGGCTACTAGATCCACCGTCAGAGGGCACCGACCATCCTTCCTTCATAGGATCCGCACTCGATCCA
CTCTTGTATAGTATATCCCATATCCATCTTAGTGAATCCAGGTAAGGGTGGATCCGAGGTAAGTCTTGGTGGATCTTGCCTTCTCGTACATCGCTCATAT
CAGATCCATCGTCATTCCATACGGGGTGCTGCTCGCCATGGCTAATCCACCACAGGCAACTTGCACCCGTGCCAAACAACCCAAATCCTCTATAATCACT
TGAAATTGTCACTGATTCGGGATAGTGACCCCGCGTCTGGACCATTCTCTTATTTCTGA