Description :
From Genome Similarity Track
Location :
contig_51:13138- 15382
Transcript NameFunction/comments
g8600.t1hypothetical protein

Sequence
2244 bases(100 bases per row)
CACAACGAACTCGTCAAACACCTAAATTCAGTCCGCTACCTGCATGTAGTTCGCTGCTATATCTCGGCTGCAGATGCATTAGTCACTGAAGCTCTAAGCC
ATGGCAGGACACGTTATCCTCAGTGGAGATCGAAAAGCAGAGCTGCGAACGCTAAACCGGATCCAAGAGAAGCTGTATGCCGTCACAGACCTAACCGAAG
GAGAAGAAATTCCTAAAGTCTCGCGTCCACACGAAGCCAAGCCCGCAGATCGCCGAGTCAGATTCGCCGGGGATGAGCAAACGACTCAGCGAATGAACCA
CAACGCCAGTAGCGTTAAGAGGAAACGATTCGCCAGGCTCACCGACGATAGCGATAATACGACTATTCGAAGCAATGTACAAGCCTCCAGGAACTCAAAG
AGTGATTGAACAAAGTTACACTACAATTGAGCGACAAGAGTCACCAAGCGCCCAGACATTGATCCGTTAGCCGTTCAGACAGAACGGCGGGAACGAATAT
CGGCAGCACAAGACGAAGAATGCAAGTGGTCAGACCTGAAACAATACCTACGAGGTGAATTCGACGAGCTCACTCGACGAAGAGCAGGAAATGCAGGCAA
AGTTGCTGACCGATTCGTGCTCAGCGAAGATGGCCTACTGTACTATCTGGGTCGCCGACGAGAGCGAAGAGAACCCAGCGAAGAAGACATGAAGCTGAGA
CTGGTAGTTCCGACACGCTCATCGACGAAATCTTAGCGAATTGTCACAACTCCATCGAGGGAGGACACCAAGGAATCGTGAGAACGTATCACAGTGAAGA
CAGACTACTATTGGATCGGATTGTATGCCGATGTGGTCAAGCGCGTCAAGCGTGCGAAGACTGCAATACCAGCAAGAGCAAACCCCACCTACGAGGGTAT
TCGCCAGGTAACGTAGTATCAGACAGACCATTCCAGATCGTGTCCATGGATTTCGTTATTCCACTACCAAAGACTCAGCGAGGAACACTGCACTGCTCCT
CTTCCAGGATCACTTTACTGGATTCGTGATCGCCAAGGCAATGAGCGACACAGGGGCACTTGAAGTGGCAAAGGCATTTGAAGAATGCATTTTTCGTCGG
TTCGGAGCTCCTTCGCTCATTCGACACGATAGAGATCCAAGATTCATGAGCGAAGTCTTCCAGACGTTTTCTGAGATGATGCAGTCTAGGTCACGAGCCA
CCCTGAGTTATCGACCTCAAGCAAATGGTCAACAAGAGCGTAGCGTCAAGACGATGATCCAGACAGTACGCGTCTACGTAGAAGACCCGTTACAAGCTGA
CTGGGATGACATCGCAGAAAAACTCGTCCACGCTATCAACAACTCAAGAGATTCGACTCGGCGAGAAACGCCATTTTACTTGGTACACGGCTGGGATGCT
CAGTCTACACTCAAATCGATGACTTCATCCATTCGCCGGCCTCAAAGCCCAGCGAAACAAACGACGTCAGCAAACGCTATAGAATGGCGCAGAGAAGCAA
ACCGGCAGCGAGAGATCGCGCTCATTCTTGCCAAGGAATACCAACTGAAAGAAAAAGCCCGGAGCCAAAGAGCATAACGAATCGTTGAGCCGAGTAGACA
GGGAGCTGTTCCTTCAACGAGTAACGAAGACAATGGACAATTAGACGAGACAAACTCAGCGAGAGATGACACAGCAACTGCAAGCGCGAACAAAGAATTA
GCTGAGTCCACACGGTCCTATTCAAAGAAGGAGACCAAGTCTGGTTGTTCATGGAACGGGTGAAACCCGGATTGAAGAAGAAACTTGCACACCGATGGCA
CGGACCTTTCCGGATCAAGCACAAGGTAGAAGAATTCGCTTACGAGCTAGAACTACCGGACAAGAGCGGCTATCGATTCTACCCCGTGGTTCATGTATCT
CGACTGAAGAAGGTGACTGAGCTCAGCGAACGTCCCACGACTCAGCTAGTCGATGGTCTCAGCGAAAACGATCGATTTGACTTCGACGAGGAGTTGCTGC
CGGAAGACAGCTGGGAACCTGACGAACGAACCGGGCGATATGAAGTAGAAGCCATTCTCGATGATGAAATGCCGCTTTCGACGAGTACCGACCGAACTCA
GCGTCTGTTCAAAGTAAAATGGGTGGGATATGATGAACCCACGTGGGAACCCTTGTCGAATTTATCGTGCGGAGGCCTTCTGTTCGATTACCTTCGCCAG
AAGAAACGTGAAAACCGTCTGCAAATGGTGCAAGTTGCAGACGA