Description :
From Genome Similarity Track
Location :
Scaffold_789:13138- 14448
Sequence
1310 bases(100 bases per row)
TTCTGTTTGGAGTCTGGATAAGTCCAGGCTCACTGAAGTAGCGCTCGCAGGACGCAGTATTAACTGCGACTGAGAGAATTGTCAGAGCAAGTTCGGGAAG
CTTGCTATTTGGTCTTTCTCGTTGAATAGCCCCCCAAAAGCTTGGCACCAAATCCGAAGTAAATGAACTCGCTGTGGCTAAGTAACTCGACTTGCCACGG
ATCCATAGGTCGAGTTCTTCGTACAAAGCCCCAACCGGTTGTTGAACCAAGCGTCGGTAGTAGTACATGCCGCTTTCGATGAAGAATATCCATGATATGA
GTGGGGCGTTCTTGCGTGTGTAATTATTTGTGTCAGTTTTCATCAAACGCCGATATAGATCGACATACTTCGAGTGAAACGCTAGACCCAAGAGCAAAAG
CGGTTGTTCACACTGGTCCCAGCGTTGCTCAAGGCAAGGcaaggcagcagctcaaacTCAAACTGGTTGCATGCTAACCCTTTGTACATCTTATAGAAAG
AGCGTACAACATCTGCCATCGTGTTATCATCTCTCTGTAGCCGCAACGAAACCTAAACCAACGGAAACGTGACGCGCTCAGCCGCAGCCAAATTCCTAAA
AAAAACTGTTCCGAAAACACTTTCAGTGGCTTCGGGAAGGTTTTGTCGTTACGGTAGTGGTGGGCGAGGTCCTCCATTGCAGGCTTCACACGAAGCAACG
AGGCAAAGCATCCGTGCATACTATTCCATTTTGTTTCGCAGAGCGTCAAGAAACTGAGAGGTTGGCGATCCTCATACACTGCAACTATTGCCGCCTGTGC
CCGAGGGAGCCACTTTGCTGATGAAGCGTTGAGCGCATTTACCGCGTCTCCGGCTTTCTTTGTGACCTCTTTGAAAGCCGCTTTCAGCACCGCCTTCACC
AGGTTGTTCATATCGTGTGCGAAACAGCGAAGCAAAACAAGTTTAGGCCACCGAAGTGCTAAAATTCGACGCGCACGTGCGCATTGCCCCGCATCATCCA
TCACAATTGCACCGATTTTCCACCCTGCCCGCTCTGCTTTGTTGATAAGCTCTTCAAGTTATCTGGCAATCTCCATTCCATCATGGCGGTCCTCAACTTT
AATCAAATCGAACTCTCCATAATAGCCACACGCACCCAACATCCATCCGAGAAGATGCTTTCGTGCCACATTTTGCCAGGTATCGGACAGTGCGTTTAGA
CGGTATCCAGGCAACTTCTGCTCCTCCCGCAACTTAGCACTACCAGCCGCCTCGAATTCACCAGCATACTTCTTCAAGATACGTCCTTCAAGCGTTTTCC
CCGACGGCAG