Description :
From Genome Similarity Track
Location :
contig_47:131344- 135435
Transcript NameFunction/comments
g9190.t1ETK71003.1 hypothetical protein L915_21668 [Phytophthora parasitica
g9191.t1hypothetical protein

Sequence
4091 bases(100 bases per row)
ATTTCCAAATCGGCAAAGTCGGACCGGAAGACCGAGCGTACGCTCTCCTACTGCGCGCTCTACTAGCACAGCCACTCTTTCACGAGTTACGAACAAGACA
ACAACTGGGATACACGGTGGCTTGCAGTGTACGTGACACGCATGGCGTGCTCGGGTTGAGTGTGAGCGTGCAGTCAGCCTCCCATGCTGCTGGTGCGGTG
GCGACCAAGCTTGATACCTTTCTTCACGAAGATTTTCCTCACGATTATCTACTCTCGGAAAAACGACTATCGCCCAAACAGTTCTCAGCACATGTGCAGA
CTCTGCAGCGGACATACGCGCGACCAGACTCAACACTGGCAGAGCAAAGCGAGCGCTTCTGGGAAGAGATTGTTAGTGGTCGTCTGGAGTTCGACTTGGA
TGTTCAAATAGCGAACGCCTTAGGAGGCTGTACACGCCAAGGTCTGCTCGCCCGGTACCAGTGCTGGTTGCAGGGAAGTACAAGCTGTTGCAGTGCCTGC
ACGGATAACCCTCACGTTGGCCGGAAGGCCCTGCATAGATCAAGCAAAAGTCACGGCCCAAGGAAACTTCGGGTGCATGTTGTGGGCAAATGCAGCCCGT
TTAAGCCGATTGAGCAACTTGTGCCGCCTGACAAGACCCCAGTGATCATTTCAGGCGACTTGCACGATTTCAAGCGCGAGCTGCAGTGCCACTGCCACAT
TGAAAATGCTAATACTTAGAGGAGGGAGACAAAGAGAGGAATCTATTGGGACTGTTTTGTCGCCTAATGCAATTGAGTTGCCTGGCACACGGATATCTAC
ATACGATACATGGGTCTAGCACCCGTGTGCCTATCAACCTTCACCTTGCTCCTCATTTGTCTTTTGGTACTCGTGTAACTCCGACGGTGTCACGAAGTTG
TGTATGGATGGCCGATGCATAGCTATAATGGTTCGACGAAGTCGTGGCGACGACGCGCTACCCGCAGCTGAACCATCGTCGCTTGATTTCGACTCTCGCT
GAAGTAGATTTCGTGTAGAACCCCGCGTCATCGACATTTCGCGTAATGCATCAGATACTACAAGACGCTTTTCTAGGTTTAGTACCCGACTCTCGATACT
CTCAGACTGTGTTTGCATGCGAACCTTCATGGCTTCCACCTCATCCGACACACGAGAAACTTGCTCCAGAAGACTCTGAAGTGTCAATTCCAGTACCAAT
GCCCACGTTGGAACATTTTCCGGCGGTGCGGTTTGAGCGAAACTCGGACTGATGCTGGTGACTTCGTTGGTTAAGGAATGGCTAGTGCCACTTCGGTCAC
TTTCTTGTAAGGTGGCCATCGTTGGGGCCTGTTGCCGAACCTGATACGATTGCAGCTGAGGGCGTAGAGGTGGCCGCTGCAATTGATTAGGCTGCTGCTG
CAGCTGTTGCAAGAGGGTAATGGAGCCACTGCTGGGTGGTAGTGAAAGTGAGCCCCCTCCATTAACTGGTGTAGATTCAGTCGGCGGCCCCGAGATAGAA
GCGGCAGCCATGATGCTGCTTAGCTTATGCGTACGATCTGCAGTTTGGGTCAGAAAGAGCTCCGAAAGCTCTTCAATCTTGGTGCGAATGTACTCGACAT
TGACTTCCATCATCTCTAACATGGTCATCTGCGAATCCATGGGGTCGCTAACATCGTGTGAATGAACTCGCCGCTTCACTTGTCGATATTTGCCCAGTAC
CGTGAACAATTTGAGTTCTGCACGACGCAGAGCTCGCTTGGTGCTGCTGGTACCTGCTTTGCCGGTACTTTCGGCAGGAGCCTCGCTTACTGAGCCATTT
TCGCCTCCATCTGCTCTGGATGAAGGACTTTGGGTATGCCGGCGTTGTGCTGCTCGTAGTTGCACGAAAGCCTGAAGTGCTCGAGCGGCATGGTCACTTA
TAATCCGGCGATTTTCGTCTTTCTTCAGGAAGGCATTGACCTTGTGTTCTGAGCGCGTGAGCACGAGGTAGTTGCTCATAACTGCGATAGTGACAGCAGT
TGAGAGGGTGCCGAATATTCCAGCACTTACTGCAATTGCACGGCCGAGAGTCGTGCGGGGTACAACATCGCCGTACCCGATAGTGAGAATGGTGATGATT
AGCATCCAAAGTGCATCACGTAGCAGCATGGGCTCGCAGCACGAACCCTCTTTGAACGCGCACAAAAATCGCTCGGACACGTACAATGCGTACCCCGCTA
CAAACCCAAGAGTAGCGAAGCTTGCCATCAAACAACTCGTGGGGTGGTTCTTTAACGTCGATTTCATGAAGAACTTTGAGGTGAAGTCAACATTGGTGAG
CGCCCCAATAAACCATCCGTTGCTCGAATTGAACGAGTTGCGGAACTGCACCACCCGCACCACGAGAGCCACGCGCGCGAACATGAACAGGCTTGTGGCC
ACAATAAGCTGTGGCCATTTCGGATCCACGGACTCGATCCCTGGAAACGGGTGAATACCTAGTACGGCCATCTCAATCAGCAGCGTACGCCGCAATGAAG
AGCTCATGAGTGTAGCCTTGGGTGGCACGATGTTCTTGAGCTTCATGACCTCGCACTCGGCAGCGTAATAAAGATAGATGTAGTAAAGCATGAGAGCAGT
CGAGAACGTAATAAGGATGCGTAGCGCCAAGAGGACCATGCGGCCTTCGCTCACCGGGACAGACGTACCGAGGGCCTCGAAACAGAGCGGACACTGCGTA
GTCGACTCCATCGGACACGTGCTAGGCAAAGTCTGTGTGTTGATGAACCACAAATACTCCATCTGCACCATCATGAGTACGACCCCGAAACCCCCAAAGA
AGAGCTGGAAGGAAGTGTGTTGTCGCTGCGAGCGTACCAGCATCATGCGCTGCTCCTGCAAAGATACCATTTCTGCACTTGTAGCTTTGACCTTGCTGCC
AAAGGCATTTGCTTTGGGTTTCTGATGTACCGGGACAGTCACTGCGTCTGGGCCGGGGCGACTGTCAGCTTCAGAGGGGTCTGCGTTGGCAATGGCGACA
TCAAGCGGCACAATTTCGTTCCTGTTCGGCATGGTCGCAGGGTAGGTATGACACGCACGGACTCAGTTGAAAATGAAAATACCGGAGATCGGCGACGCAC
GAGACGACGACCAGGACACGCGGGCATTCACTCGCGCTCGGCTGGAGTTGATTGCCCAGGGTGCAGCAGCAGTTTCTAGCCCTTCCTCCAAGTTGTTTCT
CGTCACTTAACGTAGTGGCGGACACCATGCGCCGCAGTTGTGGTATAAATAGAGCGCGAGGGCGAGGGCAGTTTCTCTTTTGAACAATGTCGTGTGCATA
CTGGAAGAAAAAAAAAGTGGGCGACTTGGCTCTTGACAATCGACATCAACAACATTGGGGCACCAGGACGTAACGCAAAGAAGCTGCTTTAACGTAGCCG
AGTCTCTACGTGGTTAATCCACTCAAATCCTCTCCTTCCCCCCCGTGCACGACGCGAGCGTCGCACAGATTGGCTCGAGTCCTGGGTCCGACTAGAAACT
TAGTAGAAGAAGCCGATGATCTTGCCACCCGTGTGTTTGCGGCGGGCCTCGTGGTGGTCCATGATGCCGTACGTGGTGCTCACGACGATGTGGCCGAACT
GGCGCGAGGGCAGCAGGTTGTTGATCCACTTCTCGTAGTCCGCCATCTTGACGTCGAAGCGGGGCGAGATGACGCCACACTTGTTGATACGGCCCTTGAG
CTCCACGACGATCTTGCCGGCGCGGTGGTCGTCCACGATCTCGAACTCGCCGATGTAGCCGTTCTTCTGCATGACCTGCAGGAACTTGACGATCACCTTG
GAGCTCGGGCGGATGAGCACCTGGCGCTTGCCGCGCTTCTCGGCGTTGTAAATGGTCTTGAGGCAGTCAGCCAGCACGCTCATACGAACCATGGCTATAG
TGGAGAAAAGACAAACACCGTTAATCCCTACTGCTAAGAGCCAAGGTCAGCCGCCGCGCTGCTGCGACTGCATGTCTCCACACTCAGAGCCCCTCGAAGG
GGCGAGCGACGGAACTGCAGACGGCAGCGCGGACGGAGCCTCCAAAGCCGCGCGAGAGGGCGCCCCGAAGGGAGCCCTGCCGCGCGGCTTC