Description :
From Genome Similarity Track
Location :
Scaffold_1:1313004- 1315556
Transcript NameFunction/comments
Phyin_T30-4PITG_00200Putative uncharacterized protein
Phyin_T30-4PITG_00201Putative uncharacterized protein

Sequence
2552 bases(100 bases per row)
CATTTACGAAAAAGCCAGCTCCAACAAACATGACTTCGTCGAGTTCCAACTCCGGTTGCACGCTCTCGCTACAGCTCCAGCAGCACATGACCATTGAGCA
GAAATACTCGCACGGATCAGGCAGTATCCGACACAGTCACTCTTGCCGATCGCGTTCGCCGCGTCGACGCTCCTGCTTGCGCAAGGAAAGCGCCTTTGCA
TGCGGTGGTGCTTCGCGTGGCTCACGCCTGGACGAACTGTCCACGACCAAGATGATCACAGTAAGCTACTCAAATACACCCAAGAAAACGCTGTCGTTCG
CCGATCAACACGGTCAGCATCTTGTGCTGGAGCGTGAGTTCTGTCCCAAGGACGCCCCAGTGTGCTACTCGGACGTACCGGTTGAAGTCACATCCGAACG
CCAGACCCGCCGACGTAACAATAGTTTTGAAATGTGGATGGAAGAGACTGTGGCGCGACAACATCTACTGTCCATGTGCGTCGTTTCGCTATTAGGCTGT
GCCCTCATCGGTCTTCGCCAAACCGCCAAGTAGCTGGCAGTACAAGTAATTATTGTCTGTTCATCGGAGCGACACCAACCTATTATTGTAATAAACACGT
GAAACATTCCATCAGCAAGTTACTTTCGCTGCTTGGTCGCCCGTGCCTTCTTTCCGATAACGGGGAGTTCCAGACGATGCTTGTCTAGCTCAACGTGTTG
CTGCAAAATACTGCTAAGAATCAGTTCGGGCGAGTAAATCCGCTCAGGATTCGCACTTGCAAGCTGCTTGCGCACCGTCGCCACGGCCAGCGCTGCCTCA
CTAGTGATCACTAGATCATTAACTCCAGGCTTTCCTTTGGATAACGCCTTGCCTCCTGCGCATTCCACGATCTTCACCAGGTCTTTTACTGGCGGTAGGA
CGGACTTGTGGTTGGTAATAAAGACGTTGTAGTTAGCGAATAGACGCTGGCGCTGCTCAGTTGACACACCATACATTGTGTTACTCAGATCGAAGTGCCA
CTTGCCTTCCGCCTCCTTGTCTCGAAGGCAGTTCGCTTGTTCATCGACCGCTGCGCCAAACCGCGCCGACTCGTCTAGCCAGCGTTGACCCAGAATGTGT
TTACAGCACGAAATACCACACAGCAATTTCACCGTGCGCTTCAGCTGAGGAGCAATAACATGCGTGGCTTTCGTGACGTCGCTCTCGTAGACAGCGCCGG
CGATCGCCTTGATCTTCTTTCGGACAGCAGCGGTGGGCTCCAGTCCCGTCAGAACGATACGGATAGATCCAACCTCAGCTTGTGATCCAGCAGGCTCACT
TTCAGTAATCGACTGGCTGTTTATAGCTCGCTTCCTGCCACGATTTGAGGGCTGCGAGCGCACCTTGGACCGCGCCAACGCTGGCGGATCCTCTTCAACC
AGCTCGACTTCAGTGGACAGCTTCGCATCATCTTTCTGTATATCGCGACTTACCTCGTCAGAGCTAGGTCGACGTGCAGTAGATTGATCGTGTTCAACAT
CGTCGCCGTTTTTCGCCGATGCGTTTTGTTTCTCGGACGGAGTCACCAGGTCAGGGACTGACTCAGCCTCCTCACTGCGCTTGGATCGCTTAGTCCTCGA
GTCACTAACGTCCGAGGAATCTCTGTGTTCACGCTTGGAGTTATGACGCCGTAAGGTTGGGCTTTGTGTGTTGTCTGGTGTCGAAAGCGACCGTCGTATA
CTTTTTGTGTCCGCAATAGGAGAACCCTCTTTTGTAGTCGACTTTGAGTTGCTTGCACTCTTCGTAAGCCGCGGTGTTAAGCTGTCCTTAAATAATAATT
GCTTCTTCTCATTTGCTGTCTGGCTCTTCATCGGCGACTCCTCCTTTGGCTCACCTTCGATCTCTGTCTCGCCACCACTGCTGTCACCTTCATCGCGAGT
TGGAAGAGCTGGAGATGTTCGAAACGGAGCGCGAGGCTTGTAGACTCTCTTTTCCACAGCTTCTGCTTCTTTCACTCGCTGCTGAAAGGAAGCAGCGATG
GAGGAGAGCCCGGCAACAGAACCGTCTTGTTCCAGCATGTCGTCCGACATGTCCGAGTCGGCATCGTCATCACTGTCCCCCATTCTAGCGTCGTCAAAAG
TTCCGCTTGCTGCCGATGCTATCGGCAATGGCACTGTCTCCTCAAAGATTTTTCGTTCTGGCTTGGGTGCTTCTACAACCCATCAAATATCAATACCGTA
AGTCATTTAGCATCACAGCTCAAAAGCTATACCGTCTTGATCCTCGGAATTTGTCATCCGGATCTGCGTCTCTTCCTCGTCCACTTCGCCTTCATCGTGG
ATCTCATCCTGAGAGGGCGTAGCGGCGACGAACACAGGCGCCAGACCCTCAATAGGTTGCGTAACAGCTTCCGTTGCTACCTGGATCGCTTGGCTTTCCC
GTTGCGTTGGGTCTCCCTCCAGCTGTGATAACGCGGCGCGCTTGCGGTGATTGGCTGTGTACCATTGACCTGGTGAATCGCGGAAACCCACGGGGGTCTC
CTGCCCAGATGATTCCCCGTCGAAAACGCACCCGGCCTCGCCACCCATGACG