Description :
From Genome Similarity Track
Location :
scaffold_1748:1313- 2902
Transcript NameFunction/comments
Pl_100375hypothetical protein PHYSODRAFT_478820

Sequence
1589 bases(100 bases per row)
TATTCGACGCGACTGAATTCTGTGGTGTTGGTGCTTGGACGGTAGAACACGAAAGAGTAGTCTGCGTGGAATGGACCTGGATGAAAGACGCCGACGGACG
AGTAGCCGAGTTGGTATTGCTCGGTTGAGTCCCCGAGGATCAACACGTCTGGAGCTGGGAAGAGTTGCAGTGATGAGTCGAAGTCCCAGTTAATCGGGTT
CGCCATCAGTGGCAATGGACACAAATGCGCTTGATCGATGAGCGTTTTGGCCAACTGTCAATGCAAAACACAAAGTCAGCAACAATGGCAACGACGCAAA
CAATGAACCGTACATGTTTGGAGATGTCCGTTTGCGATACCGACTGGATAGCCTCACCGCTCTCGTCCATAGCAGCTTCTTCTTGTTCACTTGGCATCAG
CGGAAGGATAGCGTGCCGCTGCATTTTTTGCTGGAGGTCATCACGGAAGATCACAATATCCTGTGTGTAATAGCGGATCCGGCACGGGTTTGTGGTGCAG
GTAACATTTGGCACCTTGCGGATGAGGTCGCGAGTACACAGATCAGGAAGCTGAAATTACGTACAAACAGCAACACCGTTAGTTAGGTTCCTGTAACACA
GACAGAAAGTTTGCAAATCTTACTGGGTGTCGAGGGAACGCGCGAGATGAGCCCGGGTCGTTAGGTCCAGGAACCAAGACAAAGCGAGAGTTTTCAGCGA
TGCCAGGGTACTTTAGAATAAGGTTTCCTAGCTCCTCCAAGTACTCACGCATGTCTTGCAACGAGTTGGATCCGGCACCTCCACCGATTGATGATGACAT
GAAATCGCCCATGAGGATGAAAAGCGTGGGTTGAACGCTCTCAAGACCTTGAAATAGCTCATCAAGCTTGCTCATGACGTGTGGGTCGTCCAAGTGAACG
TCGGACAACACAATGAACGTGGCGTGGTGGTCGTTAGCTTCTAATTCTCGGATCTGTTCCCGTTGCTGTGCTGACACCTCCACACCCAGCGGATCTATTC
CACCCAGAACTTCCATAGATGCTTCCTTCGACTCTGGAGGTGGGAAACCCATTGACTAGACACACCAGCAACACGATTAACATATTAGTCAAAGTTCAAC
TTTACAGTTGCAACTTTCACGACAATCCTTACCTGCACGTGAAGCACATCATCGATCACTTCACCTTCCACCAGCACCACGCAATTGATCGTAAAGAGAC
CATCCGTGTAAGCCGCATTCGTAAGATCAATAATAATCCGTGACGTGAAGTCTTCCAGGTAGAATCGCTTGCGTTCATCCTGACCCAGCATGCCAATCAC
GCGCCGTACTCCATTCACACCCAGCAGCGACTCGATCCGCGACAACTATACAAGACAGGTTTTAGGTGAGCTTTGAAATTCCACATCGAACAAAATATCA
AGAGAATTGTCGACCTACCTCCATGTACTCTGTGGTGTTCGCCACCGCAGTGGAGGGCGGTGCAAACAGTCGATTCCGCTTCACACGAAGGTCCATCGAC
ATGAATCTGTTCCTCAGTAGTTGAATCCTTGACTCGGGTCCAGCATGAAGTCGGCGGTGAGCGTCTGCTCTCAGCTCGTACGAGTTGTT