Description :
From Genome Similarity Track
Location :
Scaffold_2487:1313- 2890
Sequence
1577 bases(100 bases per row)
TGACATCATGTCGGTGATCTTCTCGACTTCGAACTCGTCGGCCTCGCGATCCACATTCCAACTATCTTCCGGTAGGAGGCCTTCGTCGAAATCCACCCGG
TCGGATCCATCCACCGAAAGCCGGGTTTGCGGCCGGTCCGGATATTCCATGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAAGCGATATTCTG
TACCTGCCGTTTCCAACTTCACCGCATGCTCCCCTATCTTTTCGCTCACCCGGAACGGTCCGTGCCATAGATGAGCCAATTTGCGGGCGTACCCTTCCTT
CACCCGATCTAAATAACGCCACACCTGCGATCCCACTTGGATTTGATGGGGACGGGCGCCTTCGTTGTGTCGATCCGCTCGATCTTGTATCGCACTCCGC
AGCCGTTCGTTCACTTGGGATCTGGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCGTCTTGGTTCTCTGTTTCTCTTCTTGGTGCTACATACCG
GAATGGCCGCTTCTAGGGTGGATTTGGGATCCCACCCATGTAAAATGGGGTGTCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGTGAGTCGT
TCTGCGTACTCATCCCATTCCCGCTGATCCAAGTCTTGAACATACATCTTGATCGCCCTCGTGATCGTCTGTACCATGCGCTCGGCCGATCCATTGGCTT
GGGGGTGATATGCCGTAGTCGCCCGCTGTCTCTGCCCCAGGATCCGGTTGAAGGCTCGAAAGAAATCAGACATAAAGTTTGGCTCCCGATCATGCCGAAT
CATCTCACTAGCTCCAAATCTTCGAAAAACGCACTCCTCGTACGATTCGGCAATGGTTTGTGCAGTTCTAGACGCACTAGCTTTGGCTATCACGTATCCG
GTAAACAGATCCACCCAGATCAACAATTCTGTGTTTCCTTTGAACGACTTGAGTAACGAGGGGATGTGATCCATGGCTATGATTTGGAGCGGGTAAGTCG
CTTGGTCATTCCCTGGAGACCCCCCTTCGATTTTGTGTCTGCCCTTGCCTGTCTCACAATCCACACATTCACCGACATATCGTTGCACACTCTTGAATAG
CCCCCTCTAGTGGAAGCAATTTAGGTTCCGTTGGTTGGTCCGACCGATTCCCTGATGTCCACCTTCTAAACTAGCGTGATAGTGATGTAGGACATCGTGT
TGCAAGGTTTCCGGCATCACCAATCTCATCAATCCGTCTCTATCCTCGCTGACACGTTTCGTAGGGGGACAATAGAAGAGCAAATCATTCCGATCCACTG
CATAATCCGTAGCAATAATACTGTAGGATTTGGCATCCTCCCGACTCAGGTCTCGTACATCCCACTTCTTTAGCCCCAGAATCCACACTTCTTCGTTCTG
TGCTTTGAGAATCCGCTCAATGCGGACTCCCTTCACAAATGTTTCATCGAGAATCTGGGGGCTGGATCCAATCCTCCTTCTGGACCTAGTGACAGCCATT
ACCTGGACTGTCCTTTTCACGGATCCAACCACCACCACTTCGTCTAGTCGGTTTAGGGTGATGAGATCCTGACGTTC