Description :
From Genome Similarity Track
Location :
Scaffold_2471:1313- 2453
Sequence
1140 bases(100 bases per row)
ACAGGAATGATTTTCCACCGGTCGAGGGAATCGTAGGTTAGATAAATGGAGCCCATGACGGCCACGTTAACCGTGCAGATAATAGATACTAGTCACATAC
AGTGGGGAGAAACGGGGTCTGAGTCTCGGAACCGTGACCGCAAACATGACAACGTTTAATGCTCGACGATTTCACCAATACCGGATAATCCAGGATTTCA
CCCGATGACGTATGTCTTTCTACTCATGCATGATATCTCCTTCGATGGCTAAACAGAAGCTGCGCGGTAATCGTTGCACTTGTATTGGCAAGGCCCAAGC
ATGACCCTGTTCGCATCATCCAGCGAGATTGACCGCCACCTACTCCATCAGGAGCTTGCACTTAAAAGGTTCATAGGCAAGACGTtggagtcgctgctgt
tgttgctaGATCTTAACGCTGCGCAGAACATTTTGCTTTCATTCCAGGTACCGCACGAACACCAGCTCGAAGGAACGTCGAGACAGTTGTAGAAGATGCA
TGACGTATTTATTACCTTTCACATACGCATTACGTGGGGTATTCATGAATAACGCTGCCCCCCCGAAGAAACTCCCAGCCTGATCTCGTTTACTTTGCTC
CAGAAATGCCAGTGTAAATGAAAATATTTTACTGCCTTCCTTGGCGAAGTGGCAAATGAATTTACCCTTCGCGAACAACACTTGTGTGAATAATGACACC
AGCATTCGCGTGAACGAATCCTCCTTGCCGATAAAATGCCACTAAAATAAGAATCTGTTGCAACTGGAATCTTCGAGTGTCTACAACGAGCGAGGGTGGT
AGGACGCGATCGAGTACATGCTCTTGTGTGATATAATTAAATACCTTGAAGAAAAATACTTCTTGAATTTCTTTTCGACTGGGTGCTGTGAGAAACgttt
gaaaaaaaaaatcagAGTCCTGCAACGCGATCGCGCTCAAAAtatgcagcgcgagcaccacTTCAGCCAGGCTTTCGACAATTAGCGAGGTAACACCAGC
GAAATTGCGTGTCGACAACGACAAAGCAACTAGGAGGAAGCTCACTTCGGCATTTGACAACAAGCGTAATGACGTACAGGCTGTACACGTCGCATCTGGT
GGGGTTGGGCAGGTTTAgggggctgctgcagcgcgttcac