Description :
From Genome Similarity Track
Location :
Scaffold_2976:1313- 2380
Sequence
1067 bases(100 bases per row)
CGCGCAAACCGAGCACAACCCCTACTTCAATAATTGCTTCACGATGTCGGACTCAAAGATGCAATCCCTCAAGTAACaacttgacgaagaagcaagcCAC
GATCCGCTTCATCACTACAGCTTCTGGCGAAAAGAAGGAGCTAGTCGATTAGACCGCTTCTACGTCAAAGGCGACCGTTACATAACCATTCGGTGGGTTG
AGGCAACGCACGCTGTCCACAATTCAGATTATCTGGAAGTCAGGCTTGAGCTTAGTACAGGGGAACTATCTACCAGCACTCGCAATAAAAATTCAGGTAC
TCGACCGCTGGTGGACGCCCTCAAAAAGTTTGAGAGGCGCTGGGAGACAGTTTGTCCTCCTTGCTGGACAACTACGACAACGCAGCCAGCCCGGTTGCAA
ACCGGGACAACGCAGTCGAAGATATTCCATCTCTCATCCAGAGCACTAGTCGGCAAGACCGCAAACAAACACAACGTTACTTCGTCAATCttagagcagc
aacaaggcaACCACGGACCTCGACACAGCAACATGACGGCAGACAGTACGCTCTTCCGGCAAGAGCATCCAGCTCACGTCAGAAAACACTAGGTGTCTCT
TCAAATGCAATTCGGAACGGTAGCGCGACCAACATATTCCAGTATTCAGCCATCTCCAGGTCATTTCTATGCAGAAGAGATGCCAACGGAAGAACGAATA
GCTTCCGAGTGGAACCACATCTTTGGGGCGTCTCATGCTACGATGCATCCAAACCATCTAGAAGTTGAGTTTGCGCACTTCGTAAAGATACCAGTTACCA
ACCGTCTCCAACCCGGTGATATGGAAGCACTGCTGGCTCTCATCACCGAAAGCGAGACTATAATAGTTATTGCACAGCTGCCCCGGTTCAAGGCAGGGGG
GACTACCGGGCTTCTTCAAAGATTTTGTAGCAGAGTTGACACCAGGCTTGACGAACTTGTACAGCGACATTCTCAACGGGGCGGAATGACAAAGTCCTTT
CTACAAGCCACAAGCATTCAACTCCGAAACTCGGCTGACGCGATGGACGATTGGTCTATTGAATATC