Description :
From Genome Similarity Track
Location :
Scaffold_12:131260- 135354
Transcript NameFunction/comments
Physo_290534predicted protein

Sequence
4094 bases(100 bases per row)
GTACGAGCAGCAGGTGACCGCCAATGCGCTGGACTATGACTCGTGGCTGGAGTACATCAAGCTCGAGGAGAACGAGGCTGCCGGTTCGCAGTCGTTTGGC
CTGGTGCGTGAGGTGTATGAGCGCGCCATCGCTAACGTGCCACCAATTCCCGAGAAGAAGTACTGGCGCAGGTATATCTACCTCTGGATTAAGTACGCGC
TGTTTGAAGAGCTGCTGGCTGGTGACAACGACGACAGCGGCAACTCGTCTGAGCGTTGCAAACAGGTTTATAAGACGTGCCTGAAGCTGATTCCGCACGA
CAAGTTTACGTTCGCGAAGATTTGGGTTCTCTATGCCAAGTTCCTCATCCGGCAGCGCGACGTCCAGGGAGCTCGGATGACACTTGGCGAAGCTCTAGGA
CGCTGCCCCAAGAAGAAACTATTTACCACCTACATCGAGCTGGAGCTCATGATGGGCGAGATCGATCGCTGTCGTAAGATCTACATGCGCTTCCTCGAGT
TTGATGCGCAGAACTGCGAGACGTGGCAAAAGTACGCCATGCTCGAGCGCCAGGTGGGCGAGACGGAGCGCGCTCGCGCAATTTACGAGTTGGCTATCAA
GCAGCCCGTACTGGACATGCCCGAGATGATCTGGAAGCACTATATCGACTTTGAAATCGAGAATGACGAGCGTGAGAACACTCGCGCTCTGTACGAGCGG
CTGTTGGAGCGCACGAAGCACGTGAAGGTCTGGATCAGCTTCGCTCAATTCGAGGCATCATCGCCCGACGACAAGGACACGCAAGGAGAGAACCTGGAGG
CGGCGCGCGACGTATTTGAGCGCGCACTGCGCTACATGAAGGACCAGGGCGGAGAGGAGCTCAAGGAGGACCGCGTGCTGTGCATGGAGACGTGGCTGGA
GATGGAGAAGAAGGGCGGCGACACCAAGATGATTCAGAAGGTCAGCGACATGCTGCCGCGGAAGGTCACCAAGCAGCGCATGGCGTACGCGCAGGACGGG
GTATGCATGGAGCTGTTTGTGTTGCTTGGGTCTGCTATGTATGGATGGTTCTAACGCTGTTGCTGTGTATTGTTTGTGCGCACAGACGGAGTTGGGCCTC
GAGGAGTACACGGACTACATCTTCCCGGACGACGAGCAGGCCCAGTCGCACCTCAAGCTGCTGCAGGCTGCGCAGCTCTGGAAGCAGAAGAAGCGCGCGC
GCGAGGAGGCCGAGAACACAGCAGAGGCCTCGGACTAATGCAATGTATTACAGCTTTCGTCCATCGGCCGCTTCAACGTACTGTGTTGTTGAAGAGTGGT
TGCCGTTTCTGTCTCATCAGCTACCACCTGTCAATCCCGATATCATCACTTCTAAAGGGATTAGCGCCTATCATCGCTCATCTCGATCATTTCATTGAGT
CATTAGCTTTTTTGAGGCTCACAAGCGCCGCGACCATGGTTCTTCCTGTGCGTTCACTGCTGCCTCCTGGGGGCTGCACGCGTGCTCTGCTTGCGCGCGC
AGGTGCATCTTGTAGCCGTGGATCTCCTCTATCTCGTGGTGCAGCTTACAGCGCGCGATACGCTTCCAACGCGCCGCCGCGCCAAGTCTTCGCGGATCCC
TCGGTGGGTATAGGCAGCCTCCCGCTGGCGCCTGAGGAGACGCAGGCGGAGCGCGAGCTGCTCAACTCGCTGCCGGAGTTCCAGGAGGCGGCGCAAGTGC
TGCTGGGCCAGGGCGGAGACGAGGCGCGGCTGCTGCCCAACTGCAAGCGCGCCGAGAAGGCGCTGCCCAAGCTGCAGCGCACCGTTGAGATCTGCCGCTC
GGCCATGGGCTTCCAGAGCGTGTACCTGCAGGCGGCGCTGCGCCACCTGGTGGCCACGCTCTTCATGAAGGGCGACGTGGCGGAGGCGCGCAAGGTCATG
CAGGAGCGCGGCGACGTGATGCAGTGGCCCGTGGCGGAGCACGAGCGCATGCTGCGGCTGCTGCTGCGCGCCAACCTGCCCCAGGAGGCGGCGGCCTGGT
GCCAGAAGGACGAGTTCACCAAGCTCTACCCGAAGGACGCGACGGTGCCACTCAAGTGGTCGCTCTACGAGCTCATCGGCACGGAGCTCAGCGGCGGAGC
CGAGCAACTGGCCAAGGCCGTGGAAGACCCGCTGTTTGTGCAGGCCGTGGAGACGCTCAGAGAGAAGAAGGACGTCGTGCTCAAGCACGAGGAGGCGAGC
GACTTGAAGGCCAGTGAGGTGCAGCTGGGACGCGAGATCCCGTACCTGCTAGCGCAGTACGCGTCGCTGTCGGTGGCCAGCACGCGCGCGCTGGAGAGAG
ACCCCAAGGCGGACCCCAAGGCTCCGCCGTCTGACGCGCAACTTGTGAGCTTGAACCAGGCTGAAGTTCTGTACAAGGAGGCGCTGGCGTGGGTGGAGAA
GACGGCTGCTGAAGATGACAAGGACGCGCTGCTGGCTTCGGGCCCGAACGCTCCGTTTGGAGCGTGGGTTGAGACCAACCTTGGCGAGCTGCTGCTGCGC
AAGAACAAGCCTGAGGAGGCGATGGAGTGGCTGGGCAAAGCCATGAGCACGCTGCAGGCAGAGCAGACCGGTGTCGGAGGCAGCGCGCTGGCGATGACGC
GTGTACTTGGGCAGATTGCCCGCGGTTGCCACACCATGGGCCAGGCCGTGACGAGCGAGGGCCTCTTTGTTACGGTGGTCGAGTCATTTGAGCGTGAATC
CAAGCTTTCTGCAACAGATCGTGTCGAGTTCGCTCGCGTGCTTCGCTCGTACGGTGATCTGCTGGCGAACTGGGAAAAGCGTGAGGCTGGTGCCGCCAAG
CGGTACGCTCAGGCCGAGCGCGTGGAGAAGGAGATTGCAGAGATGTGCAAGGCCAACCAGAGCGCCGCCGCGCTGCACCCCGTATTTTATTTGCCGCTGT
GAGGGGGTGAAGGAGTCGGCAACAAGGAGCTCTGATATGCTTGATAGTCGAGCAAACATAAGTAAGCTGTAAATGGTGCGCCTAATGGAATACTCGGCTT
TTCACGTGCTACTGCTTGTTCATTTCATCCAGGGGGGTTTCGGTTATCCACACGCAGGGACACTGGGCAACGAGACTGCACTACAAAATGTCTCGTCAAT
CCTGCAGACTTGAAGACGAAAGCTCAGTCCATGTCGACAGCAACGTAATCGTGGCGATACGGGGGGCTTTGAGCGTGCCTGCGAGTAGGCTGGACACCAC
TTTGAACAAGTCGCTCGGATCCCGCCAACGAGATAGCGCAAAACAAGAAGAGGAACGATACCCCCATCTACGAACAGCAACGCAAATACATCAGCACGTG
GGAGAAAGATCACAACAAGTTCCAACATCACCGACGTACCAGCAACATCCACGGCATGATAATGTCAAAGCTGGACATGCTCTTGCCCTCCAGGCGATCC
GCGAGCAGGAAGAATGGCGCTACGAGCATCAAGATAATGCCGGCAGTAAAGACCGCGTCCAGGAGTCGGTGCGCGGACGTCGAGTTGATGTACTTCTTGA
CTGGGTACCAGCAGAGATAGGCCACCAGTATCCACACAGGCGTCAACACGCGCCACCAGCTCGAAGCGTCCAAGCTGCCATCCACCTTCATACCAATGAG
CAGCGCTTGAGCGATGCGCAGCAGCGTCATGATCGACTTGCGCACCACGGCCTTCACCAGCATCCTCCGCTCCTCCACAATGGCCGCCGTCTCCGAGAAA
CTGGCGCCGACCGTGTCATTCACGAGCATATAGTTGCCCAGTACGCCGCCTGTCACCGTCTCGAGCAGGTTGAGCACCTCGTAGACGAAATACGGCGCCA
AGACCGCCACGAGGCTCCAGTCCACAACTCCATCCAACTTGAGCGCGATGAAAACTTGCACCACCAGTAGCAGCAACTCCTTGACAAAGGAGTAAAGCTT
GCCGTCTGCAAACACCAGTGAGAAGAGCAAACTGCCGTAGTAAACGACGTTCAGCACCCACAGAGGGGTGAAGACCACCCTCCACGAGTTGGAGATCAAC
TCGTCCGCTTTCAGACAGCACAGAACTGCAGCGAAAAAAGTCACACAATTAGTTGCCACTCTGCTGGTATAAAGTATGGAGTAGCATGACGTAC