Description :
From Genome Similarity Track
Location :
Scaffold_18:131252- 142415
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007413Similar to Rv2228c: Uncharacterized protein Rv2228c/MT2287 (Mycobacterium tuberculosis)
Pytul_DAOMBR144PYU1_G007412Similar to ankrd29: Ankyrin repeat domain-containing protein 29 (Danio rerio)
Pytul_DAOMBR144PYU1_G007411Protein of unknown function
Pytul_DAOMBR144PYU1_G007410Protein of unknown function

Sequence
11163 bases(100 bases per row)
ATGCGGAATCGGATGACTGGCTCGAGCACGTCCAATTTCGGCAGTCCACAGATATCTGGAACCAGAAAGGCTGTCTCACGCCGTATCAATTGTGGACTAC
CTACCGGATATCAACTCTCCAATTGAATCTATACCACCCAGGCCGCGTATTATCTTCAGCTTGCCCAAGTAATGCAGGCTGCCGGGATACGAAGGAAACA
GTCTCACACATAGTGTGGACATGCAAACGAACCCAGACAATCTGGACGTTCTTCTTTGAAAGGTGGATTGGAACCAAGATGAGTGAAGGTAGACTGCCCA
TTTTTTTGCCACATATCGCGAGCAGGACGTCACCTACAACCAAGCAATCACTATGGAGACGGCTGGAAACGCAGTATGGTTTCGTGACGGAGGATCACGA
AAAGGCGATGCAAGTAATTTGGTTCATGGTACCTCCGATTGAGCAGCGTTTCTCGGGTACTAACGAGTTCATCCTCTTCTTCGATGGGGGCTCACGGGGC
AACCCCGGGCCAGGGGGAGCTGGTTCGGTGATATTGCGACTAGACCGAACTGGCAGGCGCGCACTCCTGGTGTGGGCAGCAAGTATGGCGTATGGTCAAG
CATCTACCACAAACAACACTGCAGAATATTGGGGCCTAATAAACGGATTGCGGTACGCGAAGGCGCATCAGTGTCAGCCGCTTCACGTTGTTGGAAACAG
TGCGATGATTATTCGTCAACAACAGCTCCACTATCCCCCAAAAAACCGTCGTTTGGCGTCCATGTATCACTGGTCCAAAAGGCTAGCGGATACCATGGCA
ATCCGATCTTGGTCTCATCACTACCGATCTTTCAACAAAATGGCAGACAAAGCAGCCAACCATGCCATGGACTCGTCCGTTTCGACGCAGTATCGGTTTC
CGACTGATCGCCGAGAAGGAGCAGAGCTCGCAAGCTTAATGGTAGGTGACACCCAACATTGGTTCGACAACCACCCGACCGCGAGTGGCGTCGACCGACT
GTCTCGACACGACCAAATGGCCGTGGCGAGACCTTTTATGCGTTTGATGTGCTAGATCGCCATCCATGACGATCACCTTTTTACCCTATGTCGAAACTAC
TCTATAGTGTAGCTCAGGGAATGGATATTGTCGTTCGCCACGCGTAATATAATATACCTTACTAAATAAAAAATAATTTGGTTCATGGCGACGACATGCA
TTCCGGTGCTTCTGTGGCGGGCAAGGAATGACATCGTGCACAATGCAAGCAGCATCACAGTCGAAGACAGTACAAAGCACATCTGGGACGCATGCCGTAT
GCAAATACGGGCCGTAGCGAAAAGGAAGGGAGTGAAACGAGGAAAGAAAATTGCAGCACTATGTATACTCCAAATCCTAAGCATCTTGGAGCATGGAGAA
CCACTCAACCGCTCGATGGACTGGACAACTGCTCGACTGTATTTTGCCGGAGGCACTCGGGGAAATCCCGGGCCAGGAGGCAGTGGCTGGGCGCTATTGC
TATTCCACGGCAGCACCAAGACGTGGTAGCTCAAGGCGTGTGGGTACATGTACATGGGACCAATGGTCACCAACAACTGGTGTGAATACAATGCGCTGAA
AGATGGATTGGCGCAATGCGGACGGATCCTCCAAAAATATGACATTTGTCTCGAAGTCTACAGAGACAGCCAAATGATCGTAGCAGTGCACAGTGGAGTC
GCGACAATAAAGCAGCCGGCTCTTCGACAGATCAACCAAAGGGTTCAACAGCTCTGCGGCCAATTTGCGTGGATGACATGGAGACACACCAAACGAGAGC
ATAACAAGATGGTCGATTTTCTGGCAAATGCAGCAATGAACGCGAGGAGCTCCAAAGTGCTAACAGAACACACGAGCGGCTTGGACACACCCTTTTGGGC
CACGGCCGAAGCTCACCTCGCAAATGATATCAAAGCTAGTCCCTCTGCCATGAGACAAACACCGCTCTCGTCGGTTTTATCGAGAATTAGGCATTCTTAA
ACTCTATATGTCGGTATAAGTTCAATAGAATTGCTTTCACGCACTTGTAAGAACAGTACCAGTCATGAAACACACACAGAGATGGCTAGCGTTCTTTTCG
AGTCACGATTTGCGAGGGGGCGTCATCAATGACGAAGCAAAGACCAAACGACCAGCTGAGACCTGCTTCTTTCGAAAAAAATAAATGAACCATAAAGATG
GTCGGATCAACGCCTCTCGTCAAGTGGGAGTTGGATTGAGGATCGAATCCCACCTACTACCTACTGGCTGGTACGTGTTCAGAACCTACCTCGCGTACTG
AAACTGAGAAGAGGGTGGTTTGAGTTCGCGTTGAAACTGTTATAACAATGGCAGGGGATCTGACGCGTGGGAGTGGGAGATCAGCGCGTGGAAACGTCTT
ATAGTAAATAAACATGTCTCCAATAACCTAGATCCTACTGAAAAGTTTATGCTCGCCTAATGGTGTGTGTGTGTCTTATTTTTACAATGGCGACGTAACA
AAAGCGAAGCCACTCTACCACCACACGTTTTCAATGTGTTGGATAAAACAGTTTAAACCCCAAAACACGCATGAGGCAGTTAGTGGGACGCCACGTTTCA
CGATGCCCAGGCGCTATTATAGCCCCAAGCGACCACTTCGCTGTACTTAATGCAAACATAACAGCGCCTTATATGCTTTGGGTGCTTGTCGATCTTCTAA
AACGAAGTATAAGCGGGCTTGTATTGCTGGTGTACATGATCCAGCATGAGCAACGCCAATGCCGTTACCGTTGCCATCATCGCTGTCCCATAAACTACAT
GGAGAAAATGGAAGGGCTGCCTGTTGACCACTGAAAATAGTGGTTGTGTGAGAGAGAGGCAAGTGGGTACATCGATACACTTTGGTTAAATTCGGTGAAC
GCTAGCAATACAAGAGCACTGTCGTTCGGGTGTTCCACTAGAACACAAGTTGGACACAGGGTTCATCTTTTTTCTCATGCTAACCGGTTACGATTAATCC
GTCGAACCCAAAACATAACATATACAAGTAGATAGAATAACTTTATGGTGCATTTCCCTGTTAAATGCATTGGACTAAAAGATGCGCGTGACCATACTCA
TTCCCATGCTGTCCTCAGAAAGTCTCACCATTTTGGCAGTGTCCACTCTTCTTTGCCGTTTATAATATTACATACCTACTCTAGTACGCTTTTTCTTTGG
TTTGGTTGGTATTCAGAAGTGATGTTTTGTAGCGACTTCAGGAGAGATTCATTCTGGCAGACTGAGCAACTCTGCGGAGTCCACGGATTGTTCGACACCA
TACCTGTTCCACATGAGGATCCAAGATGGCTCGTTGCGTGTGCTCTCAGAAGCCTTATCAGTTATGCATCTTGAGTCTTTGTTGTTTCTCACGTTGGCAT
CTTTAACCAGACAGGGGCTCTGAGGTTACCGTCACTTTAAATTATACTTAGTAGCCTAATTTAATATCACAAGAACCACTACTTAAGCATATTATCTTAT
TTCACTAAATATTGTAATTAATAATGCTACATTCGAAGCCCCTTTATAAAGTTTCTCGATTTTGTTTTCACCCCCACCTTTGCGTTATTTAATTTCGCGT
GCCCAGAGAGAGAACAGAGAGAGCGCAGCCCTCGTTCCTTTATGAGGCTGCGCATCGGATGCGCCTGCTGACACTCCCGCCGCTCATTTACCATTTCTCC
ACTCGCCGCCCACATCACCAGCCATTCAGTCGGACGCGTCCCCATTGCACAGTATCGTCATATCGTACTAGCTCCAGGTATCAGCCGCCTCATCAAAACA
AAACAAAAAATATCAAGATATGGCTTCACCCAAGTTGACGTCGAAGTACATCGACACTCTCAACCCAGAACACGAACGCAGTCTTGCGCGAGATGAACGC
CAGCAGACGTGGTTTGCGGCCGCGGAGATCGGTGATGTCGTGACGATGGCGCACGTGCTACTCTGGTCCAAACACATTGAAGAAGCGCTGCTGATAGTGC
TCTTGGTGCTTTTCTCACCTCGACGGCAGTCAGCGCTTGTGGTAAGTTGAGCCTCGTGAGCGAAAAAGGCTACTTATTGAGCATGATCTCGAAGCTGCAG
CTGACATCGTTTATTTTCTTTTGTATTTGTCAACTCTTAGGCATTGCAGCACATTTCGGTCTGGGCAACGGCGTTCCAAGCCCACACACTCGTCCACAAG
CTACTTTGCGATGCACTTGGGCAGCGTGAACGCGACGATGTATTGTCATCCGTCTCAGTTCCATGAAGCATTCAGCAGCGATCGCCAGCATTATTTTTAT
TTTATTTTATCATTCCAACGTCAAGAAGTACCATTCAAGAAAGCCAAGGAAAAAAGTGGTCAGAGTTCAAGGAGATGCGCGAGTGGGCATAGTTCCATCG
GGCAGCCTCCAAAACTTTCGTCGTTTCGAGTGGCTGAAGCCAAAATGGATAGTCATGACGACAACGCCGAAGCCTCGTGCCCTGCACATCCATGCCCATC
CAGACTCGTCTTGTGTCGTCAGTGTCGACATCCATTCCAACGGAGACAAACCAGATAAATGACCGTGTATTATGTAACTAGAGGTGGCCACAATCAAAGT
TCCTCAGGCAAAGAACGCGACAAAGCACTTTCTCAGAAAAGTACTCATTGGAACACTCACCAAAGTCCAACGGAACATGCTTAATTGACACGCATAATCG
GAGATGCTCCCGAATTTCGAGTTTTCGCAGTTTCAACCTATGAATGGGTTCATGTTTTTCTTCTCTTTTTTACGCATCATATTGGGGTCTCAATCAATAG
ACAAACTCGACCAATTCCTCAACTAACAGAGAAAAAGCTTTATAGTCACAGACCTTTGTGCCAGGCACGACGATCTCCTAATCATGCTTACTGTACGACG
CACGATGCACTCGGAAGGGTCCGTCAATATGAGGCATTTTTATTACATTTTCCCGCTAAATGGACTGTTCTACGAGTGCGACTGTGGATGCGAGCTTCAA
CAAACTTTTAAAAACTGGATGCGTGGACGCGTGAGTTCAATGGGAGAGAGAAGGTCATTCTATCTAACTTATGATCTACATATAGTTTAAGAATTCCAGA
GTCTCATTAACACTGCTGAGAGTGAGGTGTTTCTAAGTTTTGACGGTGTGGCACCGACGTCATTGTCGAGTAGATCTGCGACTTGGGACATAAGAACTCG
ATCATTTCCCCGCGATTCGTCGGTGAGTATCTTCGCACTCTTGGAGTTCATTGCCATGTTGGCGAGAAGATCCGCCATTTTGTTTTGTTCTCGTTTTGTG
TGATTCCAGGAGACCCACGCAAAGTTGTCGATGATTTGATTTACCCGAACTGCTAGTGGCTGCAACTTGGTCTGGCGTATTGAGGAAAACCCGTTCTGGG
CTGCTATAATCATTTGGCTATCTCCGAAGACTTCCAACTTGACTTCATAATGCTGTAGGTAGTGTGCACTGTATGCCAGGCCTTCTTTCAGTGCGCTGTA
TTCGCACCAATTGTTCGTAACTTCTGGTCCCATGTACACATAGCCGCATGCTTTGAGTTCCCATCGATTGCAGCGTTCATTCAGGAAGGTGAGTACCCAT
CCGCTGCCTCCTGGACCTGGATTGCCGCGTGCACCTCCATCGAAATACAGACGCGCCGTCGCCCATGCTTCCAGTTGGCGCGAGAAATCTTGTCTCTCCA
GTACACTGAGCAGTTGGCTCAGGCAAGTTGCATTGATCTTTTCTCCTTTGAGCGTTCTCATCCGATGTGCCACAGCCCGACGCGTGAGTTCAATGGACAC
AACGCTGGCAAAGGCGCGACTACTGTAACTGACTTTTTCTTTGAGTTTTTGTCGATTCATACGCTGAATTGCTACTGTAGCCTATTGAAGCACTTTGCGT
CGAAAACGGCCATTATACGGTTTTTCGAATTCTGCGAGGAGATTTTAGAGATCGATTACAGATAGTGTAGACTCTCGACTGCTAGTAATCCTTTTGTGGC
CCATCCCAGCCGGCATCTTTGCTGACGTATACAAATGCTCGCACACGTGGGAAGCCACAGACTTTTACGTATGTAGGTGGTTTGCACAGAACACGGAGGA
GTTTTCCTCAGCATCGTTGGTGGGCGTGCGTTACAGCTTTGCCAGTTTTTGCTGTATCCAATGGTACTTGTTTCCGAATCAGCAACATCATCTCCCAACA
TCTCGATAATGATGCAGGGTGCACGACTAGTTTTATATTATTAGGTTTTAAAATAGGTTTTACACTAAAACCTACCAGTCGGCTTTATCGGGAGAAATTC
CTATGTGATAGCTGGGCTTAAGATCATCCGCTTTTAGGTAACAGGCACTAGTGTATCAGTGCCGTGGCGGCTTTACTCAGTTCAATACAGACGAGGATGA
ACCGTGGCTGTGCTTCAAATGCAGCGTGACCGTCTGGCAGATGCGGAGCTCACAGATAGCAGGCTACCTTTGATGTGTTCCGGCTTCGATTCTTAAACTG
AACACACACATTGTGCGGCCATTCCTCATCCTGTGCGCAAAGAACTTAAGCATGAACAGGTGGCGGGATTATACTATTTTGCCGGGCTCGGCAGCTATTC
TACTAGATGGGGTTTACGTTATACGCCAGCAACAGCAACAGCTTCTGGTCGATATCGTGCCTGAGCGACGCACCGCTTGCGACCGGCCTCCAGGACCTTG
CTTGGTAGCTTGTTCATCATTTCCTGCAGGCGAGAGATCGATCATTGGGAGTAGATTATGGATGGATATCACCGCGCTGGATACCCACGCACTTTGCTCT
CTACAAGTCAATGACAGGTGAGACAGGTCATACACCATGGTTGGATTAGGTTTTAGATGAATATAACCCAATCCAATCGATTTTTGTCGAGAAACTCAAT
TTTTACCAACCCTGTAACGATGTGATGCGTTGGGGCACTTCACTCGACAACGCCAAAACCTCTTAGGACTAAAAATATTGTAGATTAGCTCCTTGTATCT
AAATAAAACCTCACCTTGTATAAACACGCACACTACCAATACCCTCATAATTCTCTCTAGGTACGACGCGAGTACTGTACACATCGTATCCTAGCAGATC
ACGCTGATCCGCGTGTGTGATGAGTGATAATCGTTCTTTGCGTTCCTTGAGACGCATCGCACGTTCGCGGATGCTTCGCTTTGGTTTCTCCCTCTGTCAC
CACTTTGTCACCACCGAAGTTGACGTGCGTTTGGCGCTGTTGTGATACAGTCTGCACTTCACAAGTTACGTTTTAACCATCACTCGAGTGAGACACACAT
GCTGTTGCGAGGGGAATGATACAGCAAAACTGACCTCAAGCTTGTTCGTCAACAGCCAACAAATAAATACTGTACCTTGCGAGAGAATTTGTGTATAAAG
TTAAAAAGCTAATCCCGATTGTCGTCTTACCTGCAGATTTCAGCTCGGCATCGATCTTTCGTTATTATCTCGACCGAGGCGTACGAAACCAGTCAAAGTT
GTCACTCGCACTTTAACTGGTGCGCACTCTCTTCAACTTTTCGGAAAACAAGCAGACACAGTAGTTTGTGCTAATAAACAGCTAAGATCGACTTAATCAG
TAGTTTTAACACGATTTGTTTTGTAGCCACACAGAGTAGGATCGAATTAGGACCCTGAGCGTTGCAGCTGGTTAGTTATCCACTTGTGATCATTGAACTG
GACAGAATAATAAAATGTTTGTAGATGCACCAGCTTACACTCCCGCGCCTTGATGAGTGTCGCGGCTTCATGTGTGCAGCAGCTTGATACGCTTCATATG
CTTTACACGACCTATCGCACAACAGTATAGAAATCGACGCTTGATCAGTTCCTTGCTCTTTTTTATCCTCCAAAACGTCTACTTACAACTTGCCGACCAG
CGGACAAACGCACGGATTCGACAGCATGCAAGGTAAATAGTACTCTAAAACGAAGCGCCTAGCTTTCGACTCGGTGATGCTCCATAGTGCGCTGTTTCCT
TCGCGACCGCCCTTTTTCTTCAAGAAAAGGCCCATCTCGCACTGCCAGACGACACAGTCATCGTCTCCATGAGAGAGACACCCTCTCAAACTTGTTAGCT
CGCGAACCTGAGTAAAACCGGTACAAATCCACTCCACTCCACTTCATTTCGAATATAACTAGTTCGAAAGCACGAAATTTTGAGCAGCCATATTGCGTTA
CCAGCGACGCTATTCGCCGAACACGTTCGGTTGGCTGGATACACGTGTAGAATGACCCGACGCGACTTTAAGAGTATCGCCAGATATTGCCAGAAGTATC
CTTGCGCTTCTGGTGCGAAGGAACTCGTCAGTTGGTGTTCGGCAAATGGTTTTATACAAAACCATTTCGTCGCGAAGCGACTGCTACGTTCGTACGCGAT
CCCAGCATGAACAAAATAAAAATCTGGAAAGTCTGACAAAGATCTACTTACAGTCGTATATAAGTAATAGTCAAACAAGCCTTTTTACATCACAGAACGT
GTCGCTCTCCGTGAGACAAAAAAAGAACCACAGACGATCCAATTATGCCTGCCACACGCCACCCACCCACCCCAAACGGATTCGCTTCTTCTTCAAAGAA
GATACTACGATACACATTTGTTTCGCTCTCCTCTTCTTCTGAGACCAAAAGGTTGATGTTTTCCCCACAAGCCTGTAGTCGGCGTCTTCAGGGAACGTGC
TGGGTTACGTTTGCTCACATGCGAATCGTGGGTTAATCCCACTTCTCTTTTTCTGCCATGCTAACGCTACTACTGTACACGAGACCATCACACGTGTACC
TGAGATCGTTAGCTACTTGTAACAACACAAAACAGAAAAGCTACGTGCCCAAGCGTGAAGATATCGTCCATACTGGCTGCCACGGCGTGTCTCAACGACC
AATGATCTCGACAATGCATGTACTGTCGCGTTTATCCACGGCGTTTTGTACCCCGAAATTTTGTTTCTTCATGACGACTGTATCATGATTTTAAAAACTA
CTCCACCAATACAGTTACGTCCGTTGTACTTGCTGAGTCTTGTTCCTTCGCCGGAATTCCGTTCATCACCCGCTCATTCCTTCCTTCCTTCCTTCCTTCA
TTCATTCTTCAATACGCGTCCTACTTGCCACAGCTGTTCGTGGTGAACATCGAATCGAAGAAATAGAGAGGAAAACATCGACCCAGTCTACACACGGAAT
TGAAGGCATTGATGGCCCCAGACGACAGCGACGAGCTACAACAACAGGATGATAGACAACGAGAAGTATGGTTTGCCGCAGCAGAGGCTGGCGATATGGC
ATCCATGGCTCACGTGTTGACACAGCACCCCGAGTTCATCAATGCCACCGAGCGTCCCCAGGTATTTTTCACATTGTTTATTAGAAACCTGTTTTTAACC
AAACATAGTAGATGAAACACTATTTCGTTCATGATTCAATACATAGCGCATGAAGTCCTTCATGACGGCACTGCAGATGTGTGCATGGCGCAACCATAGT
GAGGCAACCGCATGGCTTATCGATGTGGGTGGCGCCGACCTCGAGGTAGCCGATGAATTTGGCATGACGGCGCTTCTAATTAATCTGGCGCGAGCCGGAT
TGGAGTTGATGTTCCCGTTTCCACTTGTTCGTTCTTGTTGTGTCGATATGAGCTCTCCCGTAGAGGTAAGGTGCCGTACATTTGTGTGTTTATTGCGAGG
TCAGTGTTTAACGCTTTTGCTACTGCCCTCGGATTGTGATTCATTCAAACCAAAGATGGAAAGACATAGGCGCAGATTTGCCAGGGACCGCTCCTCATGT
CAAACGATCGATACGACCACTCTCGAAGTACTGCTCGCGAGAGGTGCCAACGTGAACCACTGTAACAATGTAAGTGAAGCTATTCCGTAATCTTGTTTTG
ATTCTGGGGGCGGTGACTAACTTGGTGTACTTAAATATATATATATATATATGTGCCAGGAGGGCGAAAGCGCACTGCTTCTAGCTATCAGCGATGGTCT
AACGAAACACGTGCAGATTCTGCTTGCAAATGGTGCTGATATCCACACTCTCGATGCTCAAAAACGCACGACTTTTGAGCTCGCATGTCAGAAAGGATAC
GTCGATATTGCACAACTGCTACTGGCCAACGACAACGAGTGCAGTTGGCAGGCTGGGGTACGTGCGTACTTGTGACTACAAAAATGCCGCTGTATCGTGA
ATTTATGAATGATTTGTACTAGGAGCAAGCATTACGAGATGCTGTGTGCCACGATTTCCCAGGGATTCTTGACTTGCTGCTCCACAAAGTGGTCGTGATT
GTGCCGGAAGAGACTCGAACAGAGGTAATACCAGTTTTTTGCATTGCTTTCATGCCTTGCACTCACGCACCTATGTATCGTCCTACTGTAGCTGCTCGGC
GCACTTTTGCACCTGGCTGTAGAGTTTGACGCCCCAGGCTGTACCTTGCACTTGCTGCTTACCGATGGTATCGACATTAATTGGAGATCTCCAGCGGAGA
AAGGGGGGCAAACAGCGGTTCACCTCGCGTGCCGACTGCGACGCTCCGGGATCCTGAGGATCATGCTCGACAATGGTGCCGATGGCAACACCTTTTGCGA
AGATGGAGAGCCTGGGAGTCGATACTCCCCGTACCACATCGCAGTCTTGAATCACGGCCATGAACAGATCGATATCCTAGCTGAGTACGGCGTAAATATC
AATCTGATCGATCATGTAAGCATACATCCGTTTTTTTGCTTATGAGTCTTGCTCTGGAATGGTTTGTCGACCCTCAAATGTGGGTTTTCACGATGTCATG
TGTCCCTTTTTGTTTATGTAGAACCAAAATACTCCGCTTCTCTTGGCGTTGAAGAAGGAGCTCGGCTTTGGAGTCATGGAACACTTGATCAGCCACGGCG
CCCACTTTTTATTTCCAACAAGCACTAGTCGAGATTCGGTAGGGATGGCGCATTTCGAGTTGTTGATCTCCACGGATAACGCCATAGCCTCTTTCTTTTT
CGTGGTTTCTATGTTCTGAAAGATTGCGCCAATTCTTGCATCGTGGCTACAAAATCTCTCACCGTTGAACGTCCCAGCGCTGATTCACTCGCTGTTTGAC
GCAACAAATCTGATCAAAGATTCCGTGAGCAAACCAGCATGCCAGATTCGCTTCGTAGTACTG