Description :
From Genome Similarity Track
Location :
contig_47:131233- 135319
Transcript NameFunction/comments
g7830.t1hypothetical protein PHYSODRAFT_491245
g7831.t1hypothetical protein

Sequence
4086 bases(100 bases per row)
ATTTCCAAATCGGCAAAGTCGGACCGGAAGACCGAGCGTACGCTCTCCTACTGCGCGCTCTACTAGCACAGCCACTCTTTCACGAGTTACGAACAAGACA
ACAACTGGGATACACGGTGGCTTGCAGTGTACGTGACACGCATGGCGTGCTCGGGTTGAGTGTGAGCGTGCAGTCAGCCTCCCATGCTGCTGGTGCGGTG
GCGACCAAGCTTGATACCTTTCTTCACGAAGATTTTCCTCACGATTATCTACTCTCGGAAAAACGACTATCGCCCAAACAGTTCTCAGCACATGTGCAGA
CTCTGCAGCGGACATACGCGCGGACCAGACTCAACACTGGCAGAGCAAAGCGAGCGCTTCTGGGAAGAGATTGTTAGTGGTCGTCTGGAGTTCGACTTGG
ATGTTCAAATAGCGAACGCCTTAGGAGGCTGTACACGCCAAGGTCTGCTCGCCCGGTACCAGTGCTGGTTGCGGGAAGTACAAGCTGTTGCAGTGCCTGC
ACGGATAACCCTCACGTTGGCCGGAAGGCCCTGCATAGATCAAGCAAAAGTCACGGCCAAGGAAACTTCGGGTGCATGTTGTGGGCAAATGCAGCCCGTT
TAAGCCGATTGAGCAACTTGTGCCGCCTGACAAGACCCCAGTGATCATTTCAGGCGACTTGCACGATTTCAAGCGCGAGCTGCAGTGCCACTGCCACATT
GAAAATGCTAATACTTAGAGAGGGAGACAAAGAGAGGAATCTATTGGGACTGTTTTGTCGCCTAATGCAATTGAGTTGCCTGGCACACGGATATCTACAT
ACGATACATGGGTCTAGCACCCGTGTGCCTATCAACCTTCACCTTGCTCCTCATTTGTCTTTTGGTACTCGTGTAACTCCGACGGTGTCACGAAGTTGTG
TATGGATGGCCGATGCATAGCTATAATGGTTCGACGAAGTCGTGGCGACGACGCGCTACCCGCAGCTGAACCATCGTCGCTTGATTTCGACTCTCGCTGA
AGTAGATTTCGTGTAGAACCCCGCGTCATCGACATTTCGCGTAATGCATCAGATACTACAAGACGCTTTTCTAGGTTTAGTACCCGACTCTCGATACTCT
CAGACTGTGTTTGCATGCGAACCTTCATGGCTTCCACCTCATCCGACACACGAGAAACTTGCTCCAGAAGACTCTGAAGTGTCAATTCCAGTACCAATGC
CCACGTTGGAACATTTTCCGGCGGTGCGGTTTGAGCGAAACTCGGACTGATGCTGGTGACTTCGTTGGTTAAGGAATGGCTAGTGCCACTTCGGTCACTT
TCTTGTAAGGTGGCCATCGTTGGGCCTGTTGCCGAACCTGATACGATTGCAGCTGAGGGCGTAGAGGTGGCCGCTGCAATTGATTAGGCTGCTGCTGCAG
CTGTTGCAAGAGGGTAATGGAGCCACTGCTGGGTGGTAGTGAAAGTGAGCCCCCTCCATTAACTGGTGTAGATTCAGTCGGCGGCCCCGAGATAGAAGCG
GCAGCCATGATGCTGCTTAGCTTATGCGTACGATCTGCAGTTTGGGTCAGAAAGAGCTCCGAAAGCTCTTCAATCTTGGTGCGAATGTACTCGACATTGA
CTTCCATCATCTCTAACATGGTCATCTGCGAATCCATGGGGTCGCTAACATCGTGTGAATGAACTCGCCGCTTCACTTGTCGATATTTGCCCAGTACCGT
GAACAATTTGAGTTCTGCACGACGCAGAGCTCGCTTGGTGCTGCTGGTACCTGCTTTGCCGGTACTTTCGGCAGGAGCCTCGCTTACTGAGCCATTTTCG
CCTCCATCTGCTCTGGATGAAGGACTTTGGGTATGCCGGCGTTGTGCTGCTCGTAGTTGCACGAAAGCCTGAAGTGCTCGAGCGGCATGGTCACTTATAA
TCCGGCGATTTTCGTCTTTCTTCAGGAAGGCATTGACCTTGTTGTTCTGAGCGCGTGAGCACGAGGTAGTTGCTCATAACTGCGATAGTGACAGCAGTTG
AGAGGGTGCCGAATATTCCAGCACTTACTGCAATTGCACGGCCGAGAGTCGTGCGGGGTACAACATCGCCGTACCCGATAGTGAGAATGGTGATGATTAG
CATCCAAAGTGCATCACGTAGCAGCATGGGCCGCAGCACGAACCCTCTTTGAACGCGCACAAAAATCGCTCGGACACGTACAATGCGTACCCCGCTACAA
ACCCAAGAGTAGCGAAGCTTGCCATCAAACAACTCGTGGGGTGGTTCTTTAACGTCGATTTCATGAAGAACTTTGAGGTGAAGTCAACATTGGTGAGCGC
CCCAATAAACCATCCGTTGCTCGAATTGAACGAGTTGCGGAATTGCACCACCCGCACCACGAGAGCCACGCGCGCGAACATGAACAGGCTTGTGGCCACA
ATAAGCTGTGGCCATTTCGGATCCACGGACTCGATCCCTGGAAACGGGTGAATACCTAGTACGGCCATCTCAATCAGCAGCGTACGCCGCAATGAAGAGC
TCATGAGTGTAGCCTTGGGTGGCACGATGTTCTTGAGCTTCATGACCTCGCACTCGGCAGCGTAATAAAGATAGATGTAGTAAAGCATGAGAGCAGTCGA
GAACGTAATAAGGATGCGTAGCGCCAAGAGGACCATGCGGCCTTCGCTCACCGGGACAGACGTACCGAGGGCCTCGAAACAGAGCGGACACTGCGTAGTC
GACTCCATCGGACACGTGCTAGGCAAAGTCTGTGTGTTGATGAACCACAAATACTCCATCTGCACCATCATGAGTACGACCCCGAAACCCCCAAAGAAGA
GCTGGAAGGAAGTGTGTTGTCGCTGCGAGCGTACCAGCATCATGCGCTGCTCCTGCAAAGATACCATTTCTGCACTTGTAGCTTTGACCTTGCTGCCAAA
GGCATTTGCTTTGGGTTTCTGATGTACCGGGACAGTCACTGCGTCTGGGCCGGGGCGACTGTCAGCTTCAGAGGGGTCTGCGTTGGCAATGGCGACATCA
AGCGGCACAATTTCGTTCCTGTTCGGCATGGTCGCAGGGTAGGTATGACACGCACGGACTCAGTTGAAAATGAAAATACCGGAGATCGGCGACGCACGAG
ACGACGACCAGGACACGCGGGCATTCACTCGCGCTCGGCTGGAGTTGATTGCCCAGGGTGCAGCAGCAGTTTCTAGCCCTTCCTCCAAGTTGTTTCTCGT
CACTTAACGTAGTGGCGGACACCATGCGCCGCAGTTGTGGTATAAATAGAGCGCGAGGGCGAGGGCAGTTTCTCTTTTGAACAATGTGTGTGCATACTGG
AAGAAAAAAAAAGTGGGCGACTTGGCTCTTGACAATCGACATCAACAACATTGGGGCACCAGGACGTAACGCAAAGAAGCTGCTTTAACGTAGCCGAGTC
TCTACGTGGTTAATCCACTCAAATCCTCTCCTTCCCCCCGTGCACGACGCGAGCGTCGCACAGATTGGCTCGAGTCCTGGGTCCGACTAGAAACTTAGTA
GAAGAAGCCGATGATCTTGCCACCCGTGTGTTTGCGGCGGGCCTCGTGGTGGTCCATGATGCCGTACGTGGTGCTCACGACGATGTGGCCGAACTGGCGC
GAGGGCAGCAGGTTGTTGATCCACTTCTCGTAGTCCGCCATCTTGACGTCGAAGCGGGGCGAGATGACGCCACACTTGTTGATACGGCCCTTGAGCTCCA
CGACGATCTTGCCGGCGCGGTGGTCGTCCACGATCTCGAACTCGCCGATGTAGCCGTTCTTCTGCATGACCTGCAGGAACTTGACGATCACCTTGGAGCT
CGGGCGGATGAGCACCTGGCGCTTGCCGCGCTTCTCGGCGTTGTAAATGGTCTTGAGGCAGTCAGCCAGCACGCTCATACGAACCATGGCTATAGTGGAG
AAAAGACAAACACCGTTAATCCCTACTGCTAAGAGCCAAGGTCAGCCGCCGCGCTGCTGCGACTGCATGTCTCCACACTCAGAGCCCCTCGAAGGGGCGA
GCGACGGAACTGCAGACGGCAGCGCGGACGGAGCCTCCAAAGCCGCGCGAGAGGGCGCCCCGAAGGGAGCCCTGCCGCGCGGCTTC