Description :
From Genome Similarity Track
Location :
scaffold_436:13122- 18688
Transcript NameFunction/comments
Pl_104875ABC transporters ABCA family
Pl_104876hypothetical protein PHYSODRAFT_351929
Pl_104877deoxyhypusine hydroxylase, putative
Pl_104878hypothetical protein PHYSODRAFT_462099

Sequence
5566 bases(100 bases per row)
TGGCGGATGAAATGCCGCCGTCACACTCGGTCTGGTACGTGAAAGCGCTGTCAAACAGCTCTTTGCACGTGGTCACAGCTGATGACGTCGTGTTGCAAGC
TCGGAGAGATGCAGCAGCTTCACAGCACGAACTCGACGCTGATGACGTTTGCTTGGAACACATGACACGGCACACGGAGTCTCCGTTGAAGTCATCGCTG
TCTGAAGATCCAGAGGATGAAAAGCTGGAACTGTCATTTCTATCCTCAAAGTCCGCAGGAATAACGTCGAAAAGACCCGAGTTGGTGACGCAGAGACCGT
AGGCAATGTCGTTATTTAATACGGTAGTGACACAATCACTTAGCGCTGTTAGAGTGGCGCTCTCGGCGTCGTCGGAGGAGCCGGCGTCAGCCATGGAGGG
ATTCTTATTGTGAGGCTTACGCTATGGAGGTTCAGCTGGCGAGACTGATTAACCGACGCTAGTTTTTTTGCGTGACTGCTACCACGCAATCAAGAGGGGA
TGGGCGTGTCAAGGAAAACTGTGAGAGTGAGTGAATTGTGGGACTTGATGGAAGTGGAGGAGCTTGGGTATGCAATGCACACTGTGAGAAGAAGTGTGTT
GTGAGATGTGATGTTGGTGTGACGCACACCGAAAGCTCCCGGGAAAAGTGGACAGGGTTTACTTGACCTGGCTGTTGGACTGCCGCCGTTAAGCGGCAAC
GGTATTGGGAATACGTGTTCAAACAGCGCGAGTTGGAGGACTGCTCGTGCCAAGGTTCGCTGTCAGTTTTGGACGGAAGGAACAAATGCTCACCGTACCG
ACACGTTGAAAAACCTCATCGTGACTCGCTGAGGGATTTGACCAGAGCAGAGGATCACAAGCAAGCAGGTTAGCCACCCTTCATGCATTGTGGATACAGT
CTATCATTACATGCTCCAATTCAATCTGAACGTCGAAATCACGCGGAGGAGGCAAACACTCAAGGCATAACTAGGAGCACCATCAGCAGTTATTAACTAC
AACACTGATTGTGTAAACGTAGTTACTACTGATTGTGCTCGAATCGCGCTAGTCGCGCGTTAAACTCGCAGCCGCGCGGGTTGCTTCGTTCACGGCGAAG
CTTACGCCAATACACAATGGCGGTCATTGTGTCATTATGACCGGTGGAGAAAGAAGCGATTGCAAACACAAAACGTTAATGTGTTAAATGACAGAGTTCC
TCGATCACGCGTTTTGCGGCCAGTGTGTTAATAACAGACTTGTATTAACTTCTGTAGTTAGTAAAGAGTTGTGAGGCTCATTCATTACGGTTTGAGAAAG
CTCTACAAGCAGCAGACTAAGACTGGCATCCTATATGTATTAAATACTGCTGATATGTTACGAACAAGTCCTCTGTTTCAATGATAAGGTCGTGAGACTG
CGTACGGGGATGCAAACCTTTTGGACGCAAACCTTTGCGTCGACTCGCACTCCACTTTGTAGTGTAGAGGAACCACCACCAGTATCAGAAGCCTCCTGCC
TTCTTGGAGGTTGCTGCATATGCATTATTTGTGTCCCATAGCTGCTGTTGATGCGATCCCATCGCTAGGAAATCGAACGGTGCCGCGTAATCTCTTGGCG
TGTCCGATTTGTACAGAGCATACACTGTTATAATTATCACTGGACACGCTCGAAAGTTATGCAACGGATGTCTCCATCTGCCTGTACCAAGGCGCTGCAA
TGCTTCACCCGAGGGCGAAAGTGAAGTGGGCGAATGCTGTCGCTGTCGCTGTCACTTGGTGGATGTCGGTGATGATTACGCTGCGCAATCAGCCGCAAAG
GCTGCATATGGCTTCAGGCCTTTCCAAAGTTGATATTTTCACATCCGCTCTCCCAAGTCCATCGGCTGCTTTGAAAACGAATATGCGGATCTCTTGCTTC
AGAAACTTGATCTTTCGTGTGTAATCATCGCCAGCTGTCGAGTCTGTCCCATGTTGCCTCAGTTAAGATAGCGTGCGACAGCTTCCGGACTTGGCCGTTC
CATCATCGGATGATACCGAGGAAGTGCCGCCATTCGCGGAATTTCGAGAAGCAGAGCAAAGGCGCAGTGAGAACCATGATTCAGGCGCTGCGGACGTCTG
TGGGTAGCGATGGCCACACCGTCGGCGACACTTGCATCGACTTGTACGCAGAACGGGTCATGATCCCGCGGATCTCGCTCTTTTCTCTGCTATCGGGCCT
CTCAGTGCTCACTCTACTACTAGTTCGTCACCGTCGACGCCGACGACGGACTCGTCAATTGGCGAAACTGTTGCCGGAGAAGGTCGTCGTGGAATCCTCG
CCAATGGCCGATGACCACACCACGTGGAAGCGCTGGTTCGCCTGCTTTTTAGCGACAACTGTTGCGTGGATCACCATCTTCTTGTGTACTTTTAATTCGT
CCACTGCGATGACATCCACGTCCATGAGTGCAGCACAAGCTCGACCCCGAATTGTCTTCAGCTTTACGACAACCACGGGAGGCATCGACGAGATGCAACC
GACGGTGGATGCTCTAGTGCATCAAGAAGGCGAAGGCTTCGACGCCGTGTATGTCATCGTCCCTCGGATGTACCGAGACAAGGTGGTGCCCATTCCATCC
TGGCTGTTGGATGAGAAGACGCTGAATCGAACCGAGTTCCGTGGGATCACTTTTGCCACCGGAACGAGTCCGTACCATGAGAAACTGAGGATCATCGTGC
TGGATACGGACTTCGGGCCTGCGAGTAAAGTGCTGGGAACGTTGTTGGTGGAGCAGGAACCGGATACGATCATTGTGTATGGCGACGATGATAGAATTTA
CCCACCGCAGCTTTGTGAACGGGCTCTGCATTATACACACAAGTACCCGGACGATGCGATCGCGGTATTGGGTGGATGGATCTCGGCCGAGGATGGACTG
TATTGCGGACGTAGCCTCGCGGTTGGTGTGAACAGCGTCTCGTTTGTAGGAGGAGCAGGTGGCGTTGCAGTAAAGCGGAAGTTTTTCGGGATGGAGGAAG
CGACGATGCCAGCATTCGAGGTCGCCAATATGTCGAAAGCCTGCTTTCTTGGTGACGACTATTATCTGTCGCACTTGTTGAGCCGCAATGGTGTGCGTCG
ACGACTTGTATCCGACAGCTGCTGGAACATCGAGGCGCTCACAGAAGCATTTTCTCATGGTGGACTTTCGTACGCTCCGTCGAAACATCCGGGTGGAGCT
AATGTCGAGCACTACCAGCAGTGTATTCGGGAACTAGGCAAGGACCAAGACCTCTCTCACGACGGCGAGTTCGGATCACTGTGCATGTTCCTATTTTCTC
GCACCTGGGGAGTCGTTCGAGGCCTGAAAAATCTATATTATGGAGGAGAATTCGTGTCGTGCTGATTGAGTTAAATGCGCATGTACAGTAAGTAGTTGGA
GCAATCCTAGGTTTAGTTGATAACGATAATATAAGCCGCATTGATGCGGAGTTCAACAAAGAATGTGATAGCTGATAAATATATCGACAAGGATAGCTGA
GGCTGGGATCATTCGAGGATAATAACTAGCACCCTGATCTCATGGTGAAAGACCTCAGATGCTGTGATTTCGTAAGTTAACCAACTAAAGGTTCATCCAA
AGCTTGCTTGGTCAAATATTTCAGGCCAGTTCTCAACTTGCTGAACACCATTCACAATTAAACTCAATCGACATTAGACGCTAATGAGTCTTCGTTTCGC
AGTCTGCTTACACTTCATTGCGGTCCTTAGCCTCTTCAAAGACACGGTTGCGATGAAGGGCGAATTGCGAATCTACAAGGAGCCAAATTTCAAGAGGCTC
CGTCGAATCATCGGCATTTCTACAGGGAATCGCTGCTACGACATGCCATGTGTTGATCTCAGTGGCGCCATTTCTTCGGCAAGGTGGACAAACCTTCCGA
CCACGGGATCGACCTTTTCCGATGGACTGGTGAAGATCGCCTTCTACGTTGGCAGCAATTGCACAGGTAAGGTGGTGGCGCTCAATACGAAAATAGGGGA
GGTTAGCAACTTTGCGGATTTCGGAACGGACAATATCACCACGTCGTTTGCTGTTTTGGAGACATCGACGAATATGCAGCATCTGACGACGGATATTTGC
AAGTGGTGAATGTCAAGGTGACAGAGGTTACAGTTTTCGTGGGTGCTTTGAATGGATTTATAGCTTAACATGTGTGTGGTAAGAAGTTCATGGTGGTATT
ACGGTAGCTGTATAAAATAAGAGAACGAGTCTCACCTTACTTTCGTGGCGATATAAGCAAATTGAATGAAGCTCTTGCTTTCAGAGAATTCATGCTACCA
AGTGAGATATCCCTTAGAGATCAGGTAACGCAAACTTCTCGCCATTATTGCGACTGATTAGCGTGCTCGCTTCCCTATTGGCTGGAGGCACATCACTTTA
ACTGAAAAAGTCACGTAGGGTTCGGTCTGGGAGCATTTTTATTTAACAATTTTTGACTGGCAGTCACTGACGTAGCCATTCGAAAACTTGCAAGACCAAG
ATGCCGTCGCACGCGTCCGTGACCGAGACCATTTCCAGCGTCCCTGACACAACTCCAAGCTTCGAGCTGCTCCGCGATGCGATGCTGGATCTGTCGGAGC
CTGTGGGCAAGCGGACACGCGCCATCTTCTACCTGCGCTCGCGTGGCGGCCTTGAAGACCTCCAGGTCCTGCTCACAGCGCTACTGAACCGCAAAGACTC
GGAGCTCATGCGTCACGAGCTGGCTTACGTTATTGGCCAATTCCAAATGGAGGAGGCTTGCGAGACGCTGCACCAGGTGCTGGAGGACGAGGCGGACGAC
GGTATGGTGCGTCACGAGGCGGCGGAGGCTCTCGGTGCCATTGGCGCGGCTCAGTCGCTGCCTGTGCTCGAGAAATACTGTGCCGATCCGGCCCCAGAGG
TATCGGACACGTGCAAATTGGCTGTCACTTTGGTGAAGTACAAGCTGGCTAAGGCCAAGGGTGAGGTCGTGGAGGGAGAGGTGGACCGTAACCCGTACCT
GTCGGAGGACCCGGCTCCTGCTGCTGAGAAAGATGTGTCTACGGCTGAACTTCGCAAGATTTTGCTGGACCATAACGGAGACATGTTTGCCAAGTACCGA
GCCATGTTCTCGTTGCGTAACCGCAACACGGAGGAGGCAGCTCTGGCCCTTGCTGAGGGATTCAACGATCCGAACGCGCTGTTCAAACACGAAGTGGCTT
ACGTCATGGGGCAGATGGAGAACCCTGTGCTCGTACCGGCACTCAAGAAGGTACTACTGGACGAAAATGAACACCGTATGGTGCGTCATGAAGCTGCTGA
AGCTCTGGGATCTATTGGTACGACCGAGTGCGAGGAGATTCTCAAGGAATACCTCAAGGACGACGTTCAAGTTGTACGTGAAAGCTGCGAGGTGGCGCTC
GACATCATGGACTACTGGGCCCCCGCCAAGTAAACGATTCCACTGCTCGCTGCAAGAGATCGCGTTTGCTGGCGTGTAGGAATAATACAATTAGTTTTTG
CATTTCACATCGTGTGTGAGTTGTCATATTTATGCTGGAATAGTTCGTAGCGGTATGCACGCGTTT