Description :
From Genome Similarity Track
Location :
Scaffold_179:13119- 15992
Sequence
2873 bases(100 bases per row)
GCCAAGGTCCTTCGCTTATCCATATTCCTTTAAGTTGGCGCTCTCTTCCGAGAAAAATATCGTTTTTTGACGCCATATCGGGCGATCATTCATCTTAACA
GCAAGACTCCTATTCAACTACATCCATCAAAGCATGATGCATCAGCGCAATCGCGATAGCTCATAAGGGGCGTTAATTCATGCCTAAGATCGTAAGTGGC
GCCCTCTTATAAAAAATTCAACCACAATAACGAAGGGCAACTTTTCATAACGCTGGAATCAGCGCAGTCGGCTTTACAATCGAAAATTCGCGATGTAAAA
TTAGACGTGGACGTTAGTGGTCGCACTTGAGTCGCGAATATGTGAACTTTGGCATTTTAGATCCCGCAGAGAGATTTAGATAGCGCCGAGAGTTGGTGTG
AGGGCTAGAACACCAAAAATACCCAACAAGATGTAACCGTACATCGTGGGTGGAACGCGGAGCTATCTTGCGAAGAAACATTTGGCTATTCAGTCACTAA
AAGTCACTTCGTTGGGGGGGGAACTAGTCATATGAAGATACAACAATATGATTTTAAAACGACGGTTCATGTTACGTTATACCTAAGAATGATGAACCCA
GCCGTCTAGCATGTGCCAAATATTTAGGGGGTTAATATAATAATATCCATTTTCCTTAAATTCACACCCTTCCCGTCAAACCTGATATTCGAATCCTTTT
GCCAAACCCCAGTAAATACACCCCTTTTCCTTAAATTCACACCATGCTTGTCAAGCCTGATATTCGCACCCTTTTGGCAACCCCCAGTTATTAAACCCCT
TTTCCTCATACTGTTTATTTATGTATAACAATCGGAAATGGTTATATACTACTTTTCATACCTTCAGTTCACACACTCCTCCAATTTTGTATCTCTCTTG
ACTGGAGTGTACCTTTCAGGGATATATGAGATGAATCTTATAATTATTGCTATGATACAATATACGAGACTATTCAGGAGTAAATAATTGCCTGTACGTG
TAATATTGAAAGAGTATGGTCATTGGTAGGCAAAATGACGAGGTTATCACCATGCAGTCTACTAATTTATAATACACACCATTTACAATTCTTCCACACT
TTTAAGCTTCTGTACCATAATAATTTACTAATCCTATAACCACAACAGTTATGGATACTATCCTCGACCTCCTGTAATGTCCGTCCGGTACTTCTCCGTA
CCGCTTGCATTCATTCTGGACTAAAAAATTGTAAAAAGGTTATCGGAATTCAAGATTCGGAGGCACACAGTAGCTGAAACGTCATCTCTGCACTCGTTAC
GCCTATCGTATGTCTTTGTGCTCAGCTTGGGCAACTCTCACGGTTGGGCCGCGGAACAAACGCACGGTCTTTTTCTCTTTCGTCTACATTTTAAACGATG
AAGAAAGCTGCAGGTGTGAGTATACCATCACACAAGCTCATCGCGTATTCTCGATGTTTGCACCGTCTATTGTTTAGGCGAAACGTAATCTTTAAAAAAG
CACAAGCAGCTTTTAGGATGCAACCGTGTGAATGGTATGCTGTCGGTCTCTAGTTTGAGACAGACTATTATTTAATTCCAGGAATGACCTACCGACGAAT
TAGCAGTATATATCTGCTGAACTGATAACAAGAAAGAATGGTTTATTATTTGGATCCCTGAATTATATCGGCTAGGTGGTACTTTTGTATGTATTAATAT
TGTAATATCTACTATTATTCGCATTGGGTGATTAAGCTATAAGTTGAATATAAACCTAAAAAAATTCAATATAAGAAATTACGGTGCAAATATTGGCTTT
TAAAGAAAGGGGGTGAATTTAAGGAAAGAGGGTGTAAATATTTAATTCTTAATATTTATTACCTTAGCACTCACTCAGGCGATGCTCGGTATATTTTGAT
TTTTGCCATTAAATATTATTTTTATTATTACTTATTCTTGTGGCCAATTGTTATTAATTATTCGGCAAACAATAATTTCTCATCTTGTGGTGTAACCTTT
ATACTCTATATTATATAGAAAAATTATTTAGCGTGCACTCCTACAAAATGTAGTTATCTTGTTTTTTATAAGGGAAGATAAAAATTCCCAACGTCCCAGT
AAACTCATGTTTACGCGGCACACATAAAAATCGATATCGTAGTCATTTATTATTACTAAATCTATATCCGCGGTTAACCCCACCCCATAAGGACAGCCCC
GGAGAGTCTCTGCCGCGGGCGCGCTGTGCCGCAGCCAATATTTGCGGGTGCAGACGGCAAAGGGAAGAAGTGAACGCGACTTAAAATCGTTGGCTCGGAT
GTTTTCATAGACAGTCAGTGCTGATGTGTCGTTTTTGTCATCTTTTTTGCTGTTATAGTTGGTGATGTTATTATTGCGATTGTTTTATTATATTTTGCTG
CTTCTGTTGCTACTGCTATCGTTGTTTCTGCTACCTCTGTTGCTTTAAAAGTGATTATTTTTATTTATATGTGTTTCTCCTGTTGCATTTAATATTGCCG
CTGCTTGTGCTGGTGGTTTTCTGCTGATGTTGTTGTTGTAATCGCTACTTTTGTTACTGATGGTACTTGAATTGTTGTCGCTTTTGCTGTTGCTGTTGTT
GGTACTGATAATACTTTTGCTGTTGGTACTGGTTAGAATTAATTTCCTTACTATACGATATTGTTACTGTAGCACATTTACTCATTCCTATAGACCCACG
CTTCTACCCTATCTGATCGTCTTTCATATTATTAGTCTAATAGCCTTTGGACTTGATTGATTGCAGGCGTATTGCAAGCAAGAAAAGGTGCGATAATGAC
TTAATCATATTCTATCAAAGTGTTTTTATATTATTTGCACGAAAACGTTGCTTTACTGGATTCGTTCAGACGT