Description :
From Genome Similarity Track
Location :
Scaffold_1:1311789- 1313377
Transcript NameFunction/comments
g414.t1RAW43320.1 hypothetical protein PC110_g503 [Phytophthora cactorum

Sequence
1588 bases(100 bases per row)
AGGTCGGACGACCTTCAGTCTCAACTGCAGATCTCCGAGTCCCATCGCACGCGGTTGAAAACTGGTACTGCATCGCAATGCCATGAAATGCTGCGAGCAA
TGCAGAGCAAGGAACTCACTTTGTTTGCTTTGTCTGTAGAAATGAAGGAGTCCGAGATCAACCATTCGCGTATCGTGAGCGAGTTGCAAACGGAGCTTAC
TCGAGCCCGTCAAGACCAGGAAACTGTCGGTGAGCGGAACGAGCTGCTTGAGGCCCAGTTTCAGCGCGAATCCAGCAACCACGCGGAGAGCAGGGAGCGG
TTAAATGATTCCGAGGTACATGCGCCTTGTAGTTGCCCCAACGAGCGATTAATGTGCACTGATTGGTATTTTTCATGTCACGACCTTGTTCATTTTTGCT
TCACGCTAGCAAACTGTGGCGTCAATCTCGCAGCTAAATGAAAAGCTGGTAGCCAAGGTCATGGAGGCTACCGAAGCTGCAAACCAGGTCACCAAGAAGA
ACAAGAAACTCCAGCAACAGCTGAGACCTTCGACACTGCTTCGACCTACCGCTGCGAGCCGTGCAAGCGCAGCTGCAGTCACTCAAGCAACAGCACGGAG
AGCAGCAACTTCGACGGCGGCTCAAAGCGGTACTGCGGCATCTCCAGCGCGAACTCTAACGAAAAAGAAGACGACAGCAGCAGGAACAACAGCTTCCTCG
ACGGCAAAGAAGCCGAAAAAGGCGAAACGCGCCAACAACATGACTCTGCTACGGGAAGCTAACCTCGGCAAGTACGTCATGTGCACCTGAATCACGTTAA
TGCTCAAGTCTGAAGACTGACCGAGTTTTCCTTGTGCTTGCACTGTTCAGGGAAATCCCTTTCTTGCTGGGCAACTCTGTGCAAGCCGTCATTTTCACTC
ATTGGAAAACATCCAGGATGCGCTTCGGCGGTGTGATACAACGTACGTGATGCCGGAACTTCTTAGCGGAGCGACAATCCCTCCAGGACCCACGTCTAGC
CATCAGCAGGGGGATGGCAAGGTTCACAGTACAAAACAGGAGAGTGGTGAAGCAAATAGCCCTGAAGTCGATGATGATAGTGCCCAGCCAATGCCATCAC
CCGTTTCTCGACAACAACCACTACCAGTATCTGAAGGTACCACAACTGCTGAATCATTCTCCTGTACCCCAACATCAACGGAAAGTGGACCCCGACGCAG
CACAAAACACAAACCACCGGCTATCAAAGTACCGACGGTGTCTCCAAAAGCGTACGCGAGCCCAATGCAGGTACGCCAGTCCTTTGCTATCCATGACTAT
GCCAGATCCCCAAGTTCACGAAGCTGACAGTGTCCATTGCCTTTTGCTGTTGCTAGTCTCAGATCATGGAAGACTTGGGTACCGCCGTTGGGGCAGCCGA
AAAGGAGTTCAAGGGGCTCAACAAGCGGTATAAAGATCTTGTCGCCCAGATGGAGGCTAATAATCGGCGAGGAGCCTCAGAAGCCTCAGGATCCGATGGT
CGCACAGCCAAGAGCTCGACATCTGCACAACTGTCACAAGCTTTGGGACCGCTGCTTGATGAGCTGGAGGCCAAAGCGAAGCAACTGA