Description :
From Genome Similarity Track
Location :
Scaffold_340:13117- 14918
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_340-snap-gene-0.11Myosin

Sequence
1801 bases(100 bases per row)
TTGTGATTTCAGGTGAGTCTGGCGCCGGTAAGACGGAAACGTCGAAGATTGTGCTGCGTTACCTGACATCGCGTGAACATTTGGCGACGAAGACAAAGGG
AGCCGCCGTGGCGGACTCGCAACAGCTCGCGATCGAGCTCGACAAGCGACTTTGGGACACCAACCCTATCCTGGAAGCTTTCGGTAACGCAAAGACGCTC
CGTAACCACAACTCGTCTCGTTTCGGTAAGTTCATGAAGCTGCAGTTCAAGCCAGAGACGAACACGCTTTTCGGTGCGTTCATTGAAACGTATTTGCTCG
AGAAGTTCCGTGTCGTCGCGCAAATCCCGGGCGAACGCAACTTCCACATCTTTTACTTTTTACTCTCGGGTGCGAACGATGCGTTGGCTGCCGAGTTGAA
GTTGGAAACGGCGGAAAAGTTCAACTACCTCAACCAAAGTGGGTGCTTCACGGATCCTAACGTGGACGATGAGCTCCTCTTTGACGAAGTCGTGAGCGCT
TTGAGCACGGTCGGCATTGATGCACCGTTGCAGAAGGAAGTGTGGAAGATTCTTGCAGGTCTCTTGCACCTTGGTAACATTCGATTGAAAGACAAGGAAA
CAGCAGAAGGCGACGTTGGTGAAGTCGCGAAGGATGCGGCGAAGTACTTGGAAGCTTGTGCGTCGCTCCTTGGTGTGGACAGTGCCAAGCTCACCCGTGT
GATCACGGAACGTGAGATCTCGACGCGTGATGAAACCTTCACGATCCGCCGATCAGCGAAAGAAGGTGGCTACGTGCGTGACGCCATCGCCAAGTCGGTG
TACAACCTCTTGTTCAAGTGGATTGTGGACAAGATCAATAAGTCGCTTGGCCATGGTGACAGCTCGCTGCCGTTCATCGGTGTGCTCGATATTTTCGGTT
TCGAGTCGTTCGAAGTCAACGATTTTGAGCAATTGCTGATCAACTTTGCGAATGAAGCGCTGCAAGCGACGTTCAACCAGCAAGTGTTCATTGCCGAGCA
AGAATTGTTCGCGGCAGAAGGTATCGACGTCGGCAAGATCATCTGGCCAGATAACCGAGAGTGTATCGACCTCATTTCCCAGAAGCCAAACGGTATTTTG
CCTCTTCTTGACCAGGAAGCGAAGACCCCAAAGCCAACGGACGAGAAGTGGAATGCCGTGCTTCACAAGACCCACGGCACGCACCCTCACTTCCTTGCTC
CTCATGAAAAGGACAAGAAGTTCGTGTTCATTGTCAAGCACTTTGCTACGCGTGTGCCATACACGATTGGCAACTTTATTGACAAGAACAACGATACCAT
TCCGAAGGATTTGGAAGATTTTGTGATGTCGAGCCAATCGGAGCTGGTGAAACAGTTGTTCACGGCGAAGACGGAAGTTGAGTTGTTGAATGGTCCTTCG
AGCCAAACCAAATTGTCGAAGCAGAGTGTGTCGGCTAAGTTCTGTGACCAGATGCAAGAGCTCGTGGACACCTTGAACGCGACGCGTTGCAACTTCATTC
GTTGTATCAAGCCGAACCCAACGATGACTCCAGGTGTGTTCGATCATGGCTACGTCGTGGATCAATTGCGATGCACGGGTATGCTTGCGACGTGTGAGTT
GCTCAAGGTCGGTCTGCCAACGCGTGTGTCGTACGAAGAAATCTGCCGCATTTACAAACCAGTGTTGCCACCATCGGTCGGACCAATGTTCAACCAGTAC
AACGACCGCACGTTCACGGAAGCCGTGTTGTGGTCGTTCCGCGTGGACCCAGATGCGTACCGACTTGGTCGCACGAAGGTCTTCTTCAAGACTGGAAAGA
T