Description :
From Genome Similarity Track
Location :
Scaffold_590:13117- 14170
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_590-fgenesh-gene-0.3Coatomer subunit delta

Sequence
1053 bases(100 bases per row)
CAGCTGAACGAGGCGTCGATCCGCGACAAGCAGTTCGAGCTCGTGTTCGGCTTTGACGAGCTGCTGACCGCTGGCGGCCACTCGGAGAACATCAGCGTGC
AGCAGGTGCGCGTGAATATGGAGATGGAGAGCCACGAGGAGAAGCTGCACAACATGATCCTCGAGAGCAAGCGCGCGGCCGCCAAGGACGACATGAAGCG
CCACACGATCCGCATCAAGGAGGAGCAGCGCGAGCGCGCGCGGCTGGAGCGCGCCGGTCTCGGCAGCATGGGCAACCAGAATTCGTTCGGCAGCGCCATG
AGCAGCGCGTTCGGCAAGTCGCCGCGCGGATACAGCGGCGGCAACGATAGTTACGGCAGCAGCAGTGGACCATCGTCGACTGGTGGTGTGCCCACGTCGC
CTTCGTCGTACAATACCCGACCGGAGCCGCCCGTGGCTGCCAAGACATCGGGCATGAAGCTCGGCGGCGGCGGCTCGTCCAACACGAGCAAGTCGTTCAT
GGATGCTATGGCCGCGGAGGACGACCTGAAGGAGGTTCCACCCATGAGCACGGCGGTGCAGGCGGTCGCGAAGCCCGAGGTCGCCGCGACTGTGAGCCAC
GACCCGATCGGCGCCGTCGTCGAAGAAAAGATCACGGTGTTGCTCAACCGCGAGGGAGCGCTGGAGCAGCTCGAGGTGAAGGGCAGTCTGTACGTCTCGG
TCAACGACGCCAACAGCGGGTGCTGCCGCCTCAAGCTGCGCACGTCGAACGCCAACGGCATCGCCTTCCAGACGCACCCGAAGGTGGACAAGCGCCTGTT
CGACCACGAGTCTGTGCTTGGTCTCAAGGTTGGTGCCACAATCTCAGTCTCGGTTGTTGTTGTTGTCGCGGTGCTGATAGATGCGTGATGGGTGTGCAGG
ACGCGTCCAAGCCGTTCCCGTCGTCGCGTGTGGCGTTCTTGCGATGGAGTCTCAAGACGCAGGACGAGTCGTTCCTGCCGTTAAATATCACGTGCTGGCC
TGAAGAAGAAGGCGGCGGCAAGGTGCGAGTTTGTGGAGCGTTTTGTGGTCTTG