Description :
From Genome Similarity Track
Location :
Scaffold_96:13115- 19841
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_96-fgenesh-gene-0.11Translocation protein SEC63
Pytir_DAOMBR486maker-pir_contig_96-snap-gene-0.19Zinc finger protein
Pytir_DAOMBR486fgenesh_masked-pir_contig_96-abinit-gene-0.55Conserved gene of unknown function

Sequence
6726 bases(100 bases per row)
CATCGATCTCTACTGGTCCTTCTTGCTCTCGGTTTCTGCTTCTTCGATCTCCTCATCCTCGCTATCACTAGAGTCCGCAGCGTTCATGACCTGCTCAAAG
AGCGTCGGTTCGTTATCTAATTCCAAATCTTCTGGGTGCGGTTGGTACACTGGAAGCGCAGCAGCTGGCGTCACCGTGAACTAAAGCATTCAAACAAAGA
AAAGGAACAATCAGCATGAGCAAATCCATGCGTAAATCTACAAAGCGCAGCGCACAATTCAAACACATAACATACCTTCGCAAGAGCGCGCAAGTCCAAT
CCGATGTACGAGTCTGACTTGACAAAGATCTCCAGCTGGTACGTGCCAGCCTTTGGAGGCGCCTGCAGCTGCAGCTTCAACTCGCCCGTGCGCTCCTGAG
ATGTGATTTTACCGAAAGCGTGCAAATGGTTGTTCTTCGTGTCGCCCACGATGCAGAACCAGCGCTCTGGCTTTGGGTATGGGAAGTGTGGCGCGTACAC
CAAGTCGCACGTGTCGCCCTCCTTGACGTTCTTGCGCGTCAGCTGGATCGTCACCGTCATGATGTCGCCCTCGGCGATCTCCTCTTCGTCATCGACCGCG
ATCGTGATGTTGAGCTCAAGGTTCGGCATCATCTCCAGCACCTTGTTCACCTCCGCCTTCTGCTCTTCGGTCAAATCGTTCAAACCCTTGCGCTCCTTCG
GGTCCATGTCGACGTACTGGTGCATGCTGCGCACAGCGTTCTTGCCCGTGATAATGTGGCGCACTTCGTTTTCGGTGAAGTGTGGCAACTGCATGAATGG
TGCGTCCTTGAAGAACAGCGCCTGTGTGAGGAACTGCTCCATCTCAATCAAGTTCAACGTCGTCTGCAACCACGACTTGCCGACCGAGATCTCTAACATA
CCGTCGACCAACTGAATCGCCTTCTTCAGCATCATGTTCAAGTCGCCCTTGAGCGTTGGACTGAGCTTCTCACGCATGAAATGCGCGTGGATGAGAATGT
TCGCCTTTGCGATCGACGGGTGGTTGTACTTTGGCTTCGAGATCAAATCCTGCTGCTTGAACTTGCGGAACAGAGCACCGAGCTCGGCCTCATCCGACGC
GCGCTTTGGGATCTCACGGAACTCCGCCGAACCAGCGAGCACCTCTGGCAGCATGCGCGGGTGCGCGTGCTCCGACATGGCAAAGTTGTAGAATCCGTAC
GTGTCGTACATGATCATGCTGTCGCCGTACTTCTTCGAGTGCGAGTACCACAGCGCGACGCACGATGGGATCGCGACGACTAGGATGACCAGGTACAGGA
AGAGCACGATGTTGTGGTTCGCAGGGTCCAAGAGGAACGTCGGCAAGCCAATCGACAGCTGCAGCGCCTGGCGACCGTCCGGGTTGCCAAACTTCTCGTA
GTTAGCCTTCGCGACTTCGTCCGTCAGCGCTTCATACGCCTTGGCGACGAGCATGAACTTCTGATCCGCAACTGCGTCGCCAATGTTCTTGTCTGGGTGG
TAGATCAGACTCATCTTGCGGTACGCGCGCTTGATCTCGCGCTCCGAGGCACCGGCACCAATGCCCAAGATGGCAAACGGGTCAAATGACTTGATCTCCG
AGTCATCCTTGAGCAAGATCGCCATCTGGTAGAGCCCGTACCAGAGCACAGCGAGTACGAGCAAGTTCGCGACGAAGAACGGCGAGAAGACGTTCGAAAG
CTTGGTCTTCTCGGCCTGCAGCTGCTTCATCTTGCGCAGCTCGCGGTCACATCGGATGTTCTGGCGGTCGATCAGGCGGTCCTTGAGGAACACGCCGTAG
AGGATGCGGCGCAGCGATAGGTACGTCATGGGCACCACGTAGAGCACGCCGAGCGAGATGGAGAAGTAGTAGAACGCCGAGTTGTCGTACTCCAACATGG
TGAACAGACGGCTTGGGGCTCCTGTGGCTGTGGCTGTGGTTGTGGCTGGTTGGTGCTGCTGCTGCTGTCTAGATTAGGGGCTTCTTCGTACGGACGGACG
GACGCTCAGCTTCGCTCGCTCGCTTCTTCCTTCCGCGTGCGTTCCGATTTTGAAGACTGCGTTTGCGTGGCTCTCCGTTTTGCTTTTGCTTTCTGTGGGG
GGCTGCGGACAGACACGTGGAGGCTGGGAAGCAAGGTGGAAGCGCAACGACCCCCTCAAGCGGCAACTGGCGGTGAGAAACGTCGACTGGGACAGGGGAT
TGCGGGATGAGGGGAACAATCTTGGATTTGTGAGAGGTTGGTTGTTGATTGATTGCGGAACGTTCATATCCAGATGAAAGCGTGAGAGAGAACGAGGAGC
GAGGCGATCCAGAGCTAGCTATTTGGTATCAAGAGCTGGTTGCATTGCATGGCGTGTGGCTCATGGGGTTATGAAGAGGGCATGGTGGATACGTTTGAGC
GCTGTGTGTTTTGTACTGTACTACATCGGGAGAAAGGTAGGTGACTGTTGTGCAACAACACAGCGCGAAAGTGTTTTGGAGCTGTTTTCCCTGGGATTGC
AACAAGCACGATCTAGACATCTTCAATTTACAATATACCTTTGTATTACATTACACATACAATAATTAATGCTAAAACACATATTTATAATAGATCAAAC
AGACGCAAACGCCTCGCCTTTTTGATAATGCGTATTTTCATGGATTAGTTTTAAGCCTCAAAATCGAATTTTAGACGTCATCAGCAATACTGTCAATAGA
TTTAGAAATAGAAATGATGTTTAGATACGCTAAACATCCAAGAGTGCCTTGTTGGAAACCAGCGAAAAGTGCGCCACCAAAGGCAATTCGAATCGAAAGA
CGCGGCGCGCCATGGGCAAGAAGAAGCGCCCCAACGACGGCGCGGCGGGCAGCGACGCGGGCGGTGCTGGCGGCGCCAACGGCAGCGGCAACGGCGGCAA
GAAGCGCATCTACTGCTACTACTGTGACCGCAACTTTGAGGACGAGAAAGTGCTGATCCTGCATCAGAAGGCGCGCCACTTCAAGTGCCACGTCTGCCAC
AAGAAACTCTCGACGTCCGGCGGCATGGCGATCCACGTGCTGCAGGTGCATAAAGAGACGATCTCGACCGTACCCAACGCGAAACCCGGTCGCGAGTCGG
TGGACCTTGAAATCTACGGCATGGAGGGCGTTCCGGGTGAAGAGAGCGCCAGTCAAGCAGGTGAATTTGTGCTGAATGTTGTGTTGTTATGTGCAAATGA
GTGATGTGTTCATCTGTGATGGCTCCGCTGTAAGGGCTGTATTTATTGACGTTTATTGACGTTGTTTTCTTGTTGTCCTTTTGCGCCTCGCATGTGCTGT
AGATAATAAGAAGCCGAGAATTGATGCACCACCACCGCAGAACGCTGGGATGATGGGAGGATTCCAGCCGCGAGGGATGCCGCAAGGCTTTCCAGTGCGC
CCGCCACCTGGACCACCGCCTCCGCACCTTCAGCCTCCTGGTATGATCGGCGGCATGCGGCCTCCACCACGAGGAGTGATGCCGCCACCGAACATGGGAT
TTCGTCCACCACCACGTCCATTCTCAGGCGGACCACCGATGGCTGTTCCTCCTCCACACATGGCGATACCAGGATTTCCTCCGCAGATCCCTGGCGCGCC
TCACATGCAGCCACCGTGAGTTTTGTGTGTGTGTTGCCTGTCGTAATCTGACGTTTTTGGCCAAAGTGGTTCTAATTGGAAACCTTATTATGACGGACAG
GTTTGGAGTTCGTCCGCCATGGGCACCACCTGGCGCAATACCAGCAGCAGCACCCGGTGCTGTCCCAGGATTCCCTCCTCATGTAGCAGGTGCAGTGCCT
CCTCTACACCAAGTTCCACCGTATATGAACGCACAGCCGCAGTTAGTGCCACCGCCGTCTTCATCGGCTGCCACTGGGTCCTCTGCTGGTCCAATTGGCA
CGTATGCGCAGTCGTTGGCAGGTCCCGAGTCAACAATTTCGACAAATCCAGAAGACCCGACGGCCCAGCGCAAGCTCGCCGAGTTGGGGCTGATTTACCA
AGACGACCTCATATCGATGGTACGTGTTGCTCACGAGTTGTTTTGCGGTGACTGATGTTTTAGTTTGACGGAGCGGAAAAATAACACAATTCACTTGCTA
CTCCTATCAAAACAGGAGGAAAAGCGAGCGCTTCGCCCACACTACCGGTACAATCCTGCGCAAGCCGCGAGTCTCGTCGCCAGCGAAGGTTAGGAGGAGC
GTTTTGAGCCAGATTTGAAGCGTATTCCATCAAGTAAACTTTTACCGTCTTGCTTACGTACTGTATGTGTGCCATCTATTGCCTGCTTCTATGGATTACA
TGAGACAATTTCTGTTTTATGGTTTTGCTACACTTTTTGAACAGGCAGACACGAAGGCAAGATTCTCATGCTTCTGGGTATCCGCCGTACTTGGAGCAGT
ATCGCTTGAAAGACTCCGACGCGGGGCTTGGCGATGGATCTCCTGGGACGTTGTTGCTCTGGGCGTCGTCATCTGTACGTGGTGATATCCCCGAGCCTTT
TCTTGCTGAGCTCACTGTTTCTACTTGAGCCTGACTCCAGTTTGCCGGTGCCGAATTGCAGTTGCCGTTGTTGCCACTCTCCTGGTGTCTGCGCGGGCTT
TGGTACACCGAGGTGAGCACTGAAGGGCCGGCCGACGCCTGGAACGAGGCAAGGTTAAAAGATCTTCGTGGACCACCATAGCCGCTGTCATCGCGCCCGC
TCCGCCCAATCGAGGTGCTGCCGCTACCACTACCGATGCTTCGTTTCGACAGCAAGTTTGTGATCGTCTCGTCATGGTCCACTGTCGAGCCGCGAGCGCC
TGAATTTGTCGGACTCACGATATCCGTCCCTAATTGTTTGATGTGCACCGCCGCCGCAATGGGAGAATCGTAGATCCTCAAGAACACATTCGTCGGAGAT
GAGACTGTGTCTTGATTATTGTTGCCATTGTCTCGGAAATCAGGTGACATCGGGTATCCACCTCCAGTCGGATCAGTGTCAGTGTGGTGGCTCTTGAGAA
AGGATCGGCGCATGAGTCGAATTTGCGTTTTCGCAACTTCGTATGACACCTGACTCCCGGGCTTGGTTGGTTCGCTGTTCAAGTCGACGAAGATGCCAGT
GAGGCTCATGACGAGTACGAGGCTCGGCATGGTCATAGGCGTTATGATGCACAATGCGACGAATGGCAGGAGTACCATCAGCGACAGGAGGTAGACTGCT
TCGTCATTCTGCAAAATGGTTGGTGCTGCGACGAGCGAGAGCCAAACCAGGTAAAAAGCCTGGCTGATCGTCGCAAACTGGAACATCCGTAGCAGCAGTT
TCGGGCTGTCGAACCAAAAGCGATCGTCATGATGGTGAAGCTGGCGGTGACAAAGCGCCGACATCTGCATGCGGATGACTGCGCGAACGCCAATCGCCAC
GGTTTTCAATGTCAAGCGCCTTGGGGGCATTGTGATGATGCTTTCAGTTCGGTTATAAGGCTCGCAGTGCGTTGAGGTGCCGTCGCTGTCATCGTCGTCG
TGAATATCTGCGAGGCGTGCTTGAATATCGCGCAAAGTGATCACGCGCAGCCGGTCGTCGACGATTCCGCGCAGGATCTTGAGCACTTTGAAGAAGATAA
TGAGGTTCGCGAGCAGCAGCAAACCACCGACACCGATGAAGATCCAGTGGTCGTACACTGGATACAGTGATGGCAGCACGGAGATCACCACGAGGATGAA
GAGTGCACTAAAGTGCAAGTCCGTGATGTGGAACAGCAGGTTCCGCATGCAGAGTACGTGGTAGCGAGCGTACGTCATCGGCGCATGCACGGGCTCTGAA
CGCAGCAAATTATGCAAGCGCCGCGGCGGTGGCTTGACGCCGAAGAGCCGCTCCATCTCCTCGGGGTTCTTGTAAATGTAACCTGAGCGATTCTGGCAAA
TGTTGTATGCCAAGATCTCGAAGCTCTTCCACAAGTGCCACTGCTTGAGCAAGTTGAATCGGAAGCACCACCCTTCGCGCTGGTATCGCTCCAGCAACAG
ACTATACGCGCGCGAACCCTGCACCAAGTCCATGCCGGACTTCGCGCGCCGCAGAGTGGACGTTCGAGTTGGATGCTGTCGTGACGTGGACGGTATCTCG
CCGCGTAGAGTGAAGCGATCTTCGGACCCATCGATTGTTCTGTCAGCGCAGTACCTGTCGTCGTCTTCAGTACCATCAAGATAGCCATCGTCATCGTCTC
GATCGCCGAATGCTGCTGTGAGCCTGTCTTCGTATTTGTTCTCGTGTTCCTCTGCGTTATGCTTGTGCCAGATCAATTTCGGCACCACTGTTCCAATGAA
GAGTAGCAGAAGCACAATCACGATGAAGTAGATCATCGTGAGGAACACGATGTAGTGGAAGAACTCGTAAAAGTGGAGCTGTTCGGACGCCGTGAGCGCG
TCGACCGCAAAGTTCATCTTCCTCATCGCGCCGCTCGTGTTGAGCGTGAAGATCACCATCGAGATGAAGCCCATGATCATCACTTCCTGGAAGATGCGGT
TCACGATCTTGCTCAGCTGCGGACAGTGGATGCCGTGGCGAGCGTAGTGGATCACACGATCGAAGAAGATCGAGACGACTACAATGACCCCGAGCAGGAA
CACTGCTGTGCCGATGTTCTCGTGTAGGCAGCGCGTGTTGCCAACGCCGAGGAACGACGTTGAGTCGTGACAGGTCCCAGTGGAGTTGCCTCCTGCCGTA
TCGCCTGCCAGCTTTCGTCTCTGCAT