Description :
From Genome Similarity Track
Location :
Scaffold_6:1311260- 1315501
Sequence
4241 bases(100 bases per row)
CACGATCACGACCCTCGTGATCGTGCTGCATCAACGCACATCCGATTGCGAAGTCGGATGCGTCACACACAACGTGGAACGGGCGATCTGGGTTGGCCAC
CGCCAAGATCGGCGCCTCAGTCAAGTCCCGCTTGACTGCATCGAAGGCCTACTGACACTCAGCAGTCCAAACCCACTCGGCGTCCTTCTTCAGGAGCTGT
GACAGCGGGCGTATCAAGCCCGCGTAGTCCTTCACGTACTTGCACAAGTACGTGGCCAAGCCAAGGAACTGCCGAAGTTCCTTGACGTTCGACGGCGTCG
GCCACTCATTGATCACTCTGACCTTCTCAGGGTCAGGACGGACACCGTTCTTCCCAACGAGCCACCCGAGCACGGGTATCTCGCTCGCCCCGAAGATGCA
CTTCTTCAGGTTCGCATAGAGCTTGTGCTTGCGTATGAGCGCAAGCAGCTTCCGGAGATGGACCTTGTGCATCTCAACATCGCTCATCCCGTCCGCAGCC
CGGCTGTGGACGAACACATCGTCGAAGTAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTCACGCACCTGTTGAAGGTCGCAGGGGCGTTCT
TCAGACCCTGCGGCATCACTAGCCACTCCCAGAGCATGCCGCTCGGCGTGCTCATAGCCGTGAGAGGGATATCGCTCTCACGCATTAGGATCTGATAGAA
CCCATCGCGCAGATCAAGAGCACTGTAGATAGTGCTCCTGGCCATCGAATCGATGATAACATCTTTTCGAGGTATCGGCGTCTGCGCCGGTATCGTCGCA
TCGTTCAGCTTGTTATACGCATGAACGATGCTCCAGCCGCCCTGTGCGGGGATTTCGATTCCCGCACTTGTCCAGCTTTGCGACGACTTTCGAAGAAGTC
GTCGATCGCTTTGACCTGCTCTCGCGGCAGTGGCCACTACCGCGTGACACAGTACTTCGTGCCCGGCACGAGATCAATCTCGTGCTGGATTCCCTTGTCC
TGCGGAAGCTCCGCAGGAATCTCTTCCGGAAGTACGTCCGCGTACTCCCGTAAGATCTCGTAGTAGGGACTCGTTTTCAACGAGTCCCAGCTCTGCTCTT
CAAAGCGCTCCTTCTTCGTCTTCGCACTGAGAGTGTCCTCGCTCTCAGTGGTGGTCTCCATGAAGAACTGCCTCAGTTCTTCATTCTCGCTCTTCGTTCT
CTCGGCGTCCGAGAGAATGCATATTTGCTCGATGCGTCCATCGTGCAAGTCACGCGCGAAGCGCTTCCAGCTCATGACTGGAAGCGAAGTCAACTCCGAC
GCTTGCGTCGGAGGGTTAGCGAGAGTCATCTCCCTGTACCGGAACCCGGCACAGGTACGCGTCAAGACGTTCAACGTCTCGACGTCCGGCTTCTCAGCCT
CCGTCTGCCCGGCAGACATTCCTTGTAGCGTCTCGGCCCCAGGCCGAGACTTGCGCAGCGATCTTCGCATGCGCCGTCTTCTTGTTTTGCGGAGCCCGGC
TCCGCTTCGTTCTTGACCTCGTCCAGGCCCAGCCGTGGGCGGGTGTTCTTCTTTAGTACCGCCGGCGGGTTCATCCCGCGGGCGAGCGACTTCAAGCCCG
GCTTGGTCGCCCGGCGCTTCGTCGTACAGCCCGGCTGCACGACAGCATGCAAGTTTTTCCGGTGCGGAACGTTTGCAACCGTCCGCACCGCCTGCAGCGT
CGGCTCCCGGAGCCGACACGCCATCTTCACCTCGACGCCTGTTATTGGCGGAGTCCTCCATTACGGAGGGTGCGTCGGCTCCCCGAGCCGACGAATCAAA
TTTGTCCATGCTATCGACTCCCGGAGTCGATGCGACTTCAATACCTCGACGCCAACCATTGGCGGAGACCCCCATTACGGAGGGTGCGTCGGCTCCCCGA
GCCGACGAATCAAATTCGCCCAAGCCATCGACTCCTGGAGTCGACGACGTTACGTCACCTTGGCTCTAATTATTGGCCAGACCTGATCCAATCAGATTCG
CGTCAGCCTCCACGGCTGAGGAGTGTGACTCGCCTGCGTCATCCGTGCCCCTTCAGGCCGGAGACTCTTCCTGATTCGCTGAAAAGCGGGTGTCGACCTC
CGAGGTCAACACATTTCCTTCATTAGCTGTCGGCGGCAACGCCGACGCTAGCTGCTCTTGCGCGCGTGCTCGCGCGCGCCCAGGGCGCTCCGGGACAGCG
GCATTGGGCGCTGTCTCGAGTGGGGAGTCGCGCGCACCTGTCGGTGCGTGCGTAGCGGCAACAGGGCCATCGCTCACTGTTCCGCTGTCGCGACCGAAGC
GCACTCTCGTGCGCTTCTCCCAATCGATGACCGGATCATGCCGTGCAAGCCACGGCATGCCCAATACAATGTCAAACTTATCGTCCAGATCCAGGACGAT
AAAGGTCTCGACAAACTCTTGATCTTCATACGTGAAGCGCACGCGTACCATGCGCTTCTCGGTCTTCACGACGGCACCCGTTGCCAGTCGTACTTCCAAC
ATACTTCGAGGTATCTTTAAATCCTCGAAGTCAAGCCTTGATAGACTTCGCAGTCGAACAAAGTTCTTCGACGCGCCAGAATCTACCAAAGCACGGAGAG
AGCCGCTTGCTCTCATCGAGTTCACATTCAGGATGACAAGGTCAGGCTTGTCATCTTGGTTCTTGCAGTGAGGATAAGCCTCACTGGGGGCTGCAGTCCT
CAGTGTCGCGTGTCCAAGGTCGACACGCGGAACTGCATTACCAGTTGGGCGCCCCGCGCCTACTGGCGTCCAGCGTTTTTTGTTTGGTTGCGACGGTGCC
CGGCACCGCCGCGATAACCACCCTGCTGGTGCACGGGGGCCGTGCACTCCCGAGCAAAGTGACCGATTCTACCGCATCGGTAGCATCGCACATTGTTTCC
TTGCGACTGCTGGGGTCCAGCAGTTGCAGCACTCGAGAGGTCCATGGGTTCTGGGCCTCCCGTCCTCACTACCGGGCGTGGCTGTGGCCTCGGCACATGT
GCATGCAGCTTAGCCTGCCGCAGGCTAAACTCCTCCTGCATTGCAAGAGTAATAGCAGCTTCGAGAGTTCTCGTGTACTCACGGAAGAGATAGGTCTTCA
CAGGCCCATCTCTCAGTCCCTTCATGAATGTGACGACCTTGGTCGCCTCGTCGATCGGATTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTCTGAGC
GTAAGCATGGACATCATGCTTGCCCTGCTGCAGGTCGAGGAACCCCGCCCTCGACCGGAACTCGTTTCGCGGTGGCTCAAACGCTTGTCTGAGCTCTTCC
TTCAAACCCTCGTACGTGCTAAAGCACGTAGGATCCGAGAGTCGGCGTTCATACGCCCAACTTCTTGCACGTCCGCCAAGACATGACATGGCGAACGCGA
CCTTCGACAACGGGTCGACGATGCGTCGAGCCGCAATGGCAGTGTCGAGTTCGACAAGCCAACGGAGGAGAGGCTCGCCCTCTCTTCCAACGTAACTGAT
CACGCGGAGCTTCAGCGATTGCACGCGCGGTGTCGTCCCCGACGACACCGTGGTAGACGAAGCAGCATCTCGCTGCTCCCTCATGATGAATCCCAGAGCA
ACACCATGCTGCTCTGTCGGCGTTAGCGTACGCAGCATCGTAGCTACAGCCGCCTCACCAATGACTGTTGACAGTCGTTGGAGAGCTTCCCACTCTGGGT
CCGACAGGTGGGGACAGTCAGCGCGTGCAACGTGAGTTGCACGCGTAGTGGAGCTTTCAATGGACACCCCCGTATCCATGGGAAGGTTCTCAGCTCCGCG
GTCGTGGGGTGACGTACGAACTCAGGTAGTCGGTCGTTGGACGGACTACAATGTGCTACCAGGTGTAGTGGGCCTACTTTGGCTCACTACTTTAGCTTAC
ACGTGTGCGCGTGTATGTGAGGAAGCGTAGCTTAGTTTAAATTAGAGTTAATTATACTCGGGCCACCGAGTATAGATTAATCTAAATAAACGATCCAAAT
AATGTTTTTGGGTTAAAATGATAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATGTAATATTCTAAGATAGGAATCTGCCAACGGCTGGTTG
GCAAAATTCCAATGCTATGCATGTCGCTCATTGGCTAAGTAAGAGATGCTGCTCTTAGCCAATAGGAATCCAAAGTCTCTATGGACCACCCGTCGTGGTG
GTCGTAAATGTATGTAGCCTTTGGTGTGTCTATACCAAGGT