Description :
From Genome Similarity Track
Location :
Scaffold_22:131123- 132673
Transcript NameFunction/comments
Phyke_g1443hypothetical protein

Sequence
1550 bases(100 bases per row)
GAATGGGGACATAGCGCTCTATACTACGCCATTGGCGCGCATAATTTTGAAATCGCCGAGTTCTTCTTAGATGAATGCTTTACCGAGGAGAAACCACAAG
AATCCGAGTTATACGACGCTCTCTTTGCAGCTGTGAACTCCGACGACGATATGTTTTTGGAGTACCTCGAGGGGAAATTTGAGCTTGATATCTGCCATGT
CAATGCCCAAGGAAGGACGGCACTACATGAGGCCGCCGCAGGGGGTGCTCTGAACATGGTTTACCTTCTTCTTGACCGTGGGGTTGACACTTGCAAATCG
GACAAGTTTGGAGTAACACCTGTTATCGAAGCGTCCCGATGTGGCCATGTCAGTATATTGCACAGCATTTTGGGTGCCAAGGGAAAAGTCGATGACTTGG
ACCTTGCTGGTAGGTCGGCTCTGCAtcatgcagctgctgctggccatgCGCATGTAGTAGAGGAGTTATTGGCACTCGATGTGGACTTGGACTGCTGTGA
TAAGTGCGGATGGACGCCATtgcattgtgctgcagcgGCCAGTCATCTTAAAGTTGTGGAAAAGCTGATCAAAAATGACGCTAGGACGAATGCCGATACA
CTTTCAGGCAAGTCTGCACTAGTCTTGGCGATGGAACGTGGTTGTTCAGATGTGGTAGATATTTTGATGGATCCTACTTCCACTGGTGACGTGTCTGTGG
CATCGAACAAGGCATCACTAGATGACTACACAGAGTACCTTCTCGATTCGGCGGAGATCCAATTCGAAACACCAGTTTTGCAAGAGAGTGCGAGTGGTGT
GTGGCTTGGCTCTCCAATCGCAGTAAAAGTGAAGAAGACTTGGCAGCCCAAGAACTTCATCGAAGAACTCGAGAGGTGGTCGAAGTTGAACCACCCACAC
GTGGTGAAGCTGTACGGTGTATGTCAAGGTGACAATGTGGAAGAACCTTTTTTCGTCTTCGAACGTCCTGCTCAGCCATCATTGTTCAACTATCTCCAAG
ATCCTGAATATGCAGGTACCCGCGCTAAGCTATGGGGCAAGTTGTACGAGGCAGCTATGGGCCTGGAGTACTTACATGATCGTGGTATCGTTCATGGTGA
TATTAGTTGCAATACCATCGCTATTGGGGAAAATGGGGCCGCAAAGCTCACACACTTCGGTTATAAGTACGACCCAGAATATCTTCGCATGTGTTCCTCG
TGGACATCACCAGAGGAGCTTTCTGGATTCCCACCTTCTTTCAAATCGGATGTGTACGTGTTTGGTTTGACCATTGTACAAGCTTTCAAAACTGAGGGAG
ATCCGTGGAATCTGTTTGGTGGATCTCGTGACGATGTAATTCGATCGGGAAAACTCCCAAATAAACCCGCAGAGATGATCCTGAGCCAGTGGCAGCTAAT
CCAAAGAATGTGCTGTATAAATCCCCGAGACCGTCTGTCTGCGTCGGATGTCGTTCGCGAGCTGGAAGCGTTGTCAGCGGACTACGAATCGACCCCAAAT
GTTTGTTCGGAGTCGGTAATGACTGTGGTGATGCCAGACTCTTGGAGCAA