Description :
From Genome Similarity Track
Location :
Scaffold_252:13112- 14762
Transcript NameFunction/comments
Aphin_H310_14840membrane protein
Aphin_H310_14841Hypothetical protein

Sequence
1650 bases(100 bases per row)
GGCAGGTCGGTGAGAGCGGTGCGATTCACGTCAAGCACTTGGAGATTCGCGCACTTATAGATAGAGGGCGGCAGCGACGTGATGGGGTTGTCGTTGAGCC
AAAGAGCGTCGAGGGACGTCAGTTGACCGATCGCGTCAGGGATCGTTTGGATATGGTTAAATCCGAGATCGAGGCGGTAGAGTGCCGAGTAGTTGAGGCG
AAAGAGGTCTGTGGGAACATTGCGCAGCCGTCTCTGCGCCAGATGCAGCAGGCCCGTGTACTTGGCTTCCTCGAGCTTCAGGTGGACGCTCATACGAACC
GTCGCGCGAATTGCCGATGCAAAACCCACCATAAATAATAAATTATCCATTCAGCAAGGTTTCGATACTGCGCCATTTTCGTGCCACTTGGACATTCTTC
ATCGAGTTGAGATGCAGGAGCGCTTGGTGCGCCATCTCGGGGCTCTGGAAGAGCAGACTCACGGTAGCCTTGGGGGACACAGACACATGAACAACGTTGG
GGTCCCTTGTGTCAGAGTACGCGTTTGTGAGGTAGAGCGGTACTAGGTGCTGCACTTCGCCGGATGTCATATCTCGACCTGGTCGGACGAGGACAAACGC
GTCGACATTGAGGATGCAGAAGAGACAATCGTCGCGATTCGTGTCAAGCATGCACGGGAGAAAGCTGATCTCGGCCATGCCCATGAGGGTGTGGCTTTGG
AACGCTTGCCTGAGCGCAGCGGTTTCGTGCTGCTGGTCGTCGAGAACGGCTTCGACGAGAGGTCTCCACGCAGGAAGGAGCTGCAGGTTCGACATGAACA
CGTGCAATGCCAGGTACTTTTCGATAGCATGTTGGTCACCTTCATTTTCGGCGTGAAAAGGCGACAAATGAGGCCACTCGACCACCACAGGAGCCGACGC
GGGAGTCAAGAGTTTAAGCAGGAGCGTATCCCATCTTGCCAAGTTCCCATGCGAGCCCGTGACCGACGGCAGCAGCTCTAGCGCCCACGTTTGACGCAAT
GTCTGCAGTCGTCGCTCGTGGTCCAATGCGAGGTGCGACTGATGCTGACTTCCTCGACTGGTGAGTTCTTCCAAAAGGCGCAGGGACACTTTGACGTGGA
TTAGAGATCGCGGCCGTGACTCCAACTGGGACAGCACCAGATCCACCCATGCGACGTCATGAGTTGGCTCCACGACTGCGTCTTGACATACGGCGTCGTC
GTCGTCTTCGTCAGATGACGCTTCGTCGTGGTGCGTCGACAGTCGAGTTGGGGTGGGGAGGTGGACGGGTTTGAGGTGGCACTCCTTCAAAAGGGACTTG
TCGATGTTCTTGTTGGACGCAATTGCAGCGAGCAGAGCCGTGGCGCCGAGACTGAGCCGGGAGTCGCTGGACTGGAGCAGAGCCAGCAGGGACTGCTGGT
GGGAGTTGCCGTCGTCGGGGAGAGGCAGACGAAGTACGTCGCTAGGAGGCCACTCGCCAATCGCAAAGCGCGTGACAAGATAGCACGAGGACGAGCATGG
AGAGAGATCGGTCGGGTCTTGGCTCGATGATTGATGGGGCTGGAATCCAACTGGAGGCAGTTTGGGCAGTACAAAGCGGGGGGACTTCAGTGCGTGGGCA
GCTGTGGGGGACAACTCGAGCTGTTTTGACTGGTGCTGGAATTGGAGGCT