Description :
From Genome Similarity Track
Location :
Scaffold_2374:1311- 3369
Transcript NameFunction/comments
Phyta_totarag14425elicitin, putative
Phyta_totarag14426hypothetical protein PHYSODRAFT_469633
Phyta_totarag14427conserved hypothetical protein

Sequence
2058 bases(100 bases per row)
GTCCCAGGTCCTGCTCATGTGCCTGACATCGGACTGCTACTCGCTCATCGCTGACCTCCTGGACCTCAAACCGGCGGACTGCGTGATCGACTTCGGCTCG
GTGTCGATCAACGTGCTGGAACTGGCGGAGAGCTTCCAGCCCAACTGCACGGCTCTCGGCCTCTCAGCCTAAGCGATCAACTCGCTATGCAACGACTACG
AGGAATGAAATTGATGTGACCGCCAGCTCGTAGTAATTGAACTCAAGAATGCAAGTTCCAGTTTGACGTGACGTTGGGTCCTCGGATCTCAGTTTTTGTT
GCtttgtacttcgaagtagctcTCTTTGGTTGCCTTTTATGCGTCCTTATGTATTTCTGGTACACGTACCTTGATGCGCCTCGACCTTCACTTTCCTCGA
TGCATTCTGGTTGTCGGGGCAGCATAAAGTCTTTGAGATGTTGTATCTTTTTGATGTGCCCTACCTTTGTCTGCTTTCTTTACATTTCACATCGATACTC
TTGATCCAAATTTGAACTGAACGAGTTGAGAGCTTttaccaccaccacggctATCGAAAATTTTGGCTACTGTAGCACAACGATGCTCGTACTTGGGTTA
GAGTCTAGCCGCGGTTCCCGTAGTTtccttgctgcagtgctgttTGATAACACGGCCCAGCTCCGCGTAGAATTCGCGGTTTCTCGACACTGACGGGAAC
TTGTGGCCGCCGTCGTGCTCAAAGATCCACTTCTTAAACCCGTTTGGCTCTGCCTTGTCCGCCCACGACAAAGCCAGTCGATGGGACTCATGGTAAAGCG
GGTCTGTCTTTCCAATGAGGTGGATCGAAGGCAGAGGAACAGGAATGCGCTTGCCTTGCTTATCCAGGAACAGCGACTTCACATTGACACCACTCACGTC
CACCCCACCAACGCAAATCGCAAGCTTCCACCAACGCACGTTGCCGTGGCGCAGGTACCACATCGTCAAAACCGTCAATAGCGCTGCGCCCTGAGAGAAT
CCAATGACGACGTCGAACGGGCCGTGGCGACGGATTTCCTCATCAACCCTCACCATCGATTGCTCGACGCCCTTGTAGGACAAACTCCACACGTGGTCTT
CTCCTTGGTCAGCGCCACTTAGAAGACGTGCCTTGGCTGACGACTCGGCGTCGTTGTACAGTAGCGGAGATCCGTCGGCCAGTTGGTTCTCAAACCATTC
ATAGAATGGGGCGCTGGACTTGTACGCACTCTCGATCATCGGGTCGCTAGTTCCACGGGCTTCATACGTGCCGTTCAGCATGACGAATTCAGCAGACGCT
CCGAGCGCAGCTCGAATGCTACGAGTCTGGTCCAGCATCACATGTTTATTCGTGCGGAACCCATGCAAACATAGCACGCGGATCTTCTTGGAGGGGTCGT
ACGAACGCGGGGTCAGCGCCGTGGGGCGAGGCAGGTTTTCGGCAACGATCACCATAGCGAAGACTTGAGCAgtgctggaagcgctgcaaAATGTCGACTG
AGCAGAGACCAATACCAACTTCAAGTAGGGTTACGTACACAAATCGGTCATTCAATGATGAGAAGGCCGTGTCACCTCTGTCGACAAAACTGAAGCAAGT
TTGGTTCAACAACATACACGAAACATGGCACGTCGACTTTATTCTGgtggttgctgtcgcttTCTATCAACACTACATCACGTTAGAGTCTTGCTACCGA
GCTCTGGCGTGTGTCTTCGAAGAATTGCCAGATTGTGCTGGCTAGGTCCCCGTAAAACCTCTGGTGTCGTCCAGGAGACGGGAACTTGTGTCCACCatcg
tgctccagcagcagtctctCCAACGGACTGCCCTTGGCGTGGGTCGTGTACATGTCcttgagcaccaacgacTCTTCACACAAACTATCCTTCTGCCCCA
CAACATGAATTGACGGGAGCGGCACCAATATCTGCTGTCCTTCGTGCGTCTCGAACAGTTCCCGGACGTTGATACCTCTTGGATACACGCCGCAGACACA
GAGCACGAGTTTCCACCACCGcttgttggtcttcttgagGTACCACATGGACAGGATC