Description :
From Genome Similarity Track
Location :
Scaffold_2103:1311- 3345
Transcript NameFunction/comments
Phyag_g12044hypothetical protein PHYSODRAFT_515521

Sequence
2034 bases(100 bases per row)
TTATAGGCGATCAGCTCGACGCCGTGCTATTCCTTACATAGTACGGCTCGTCCTGGAACTCTGCTCCGCAGTACGGAAAGGTGGCACCGCTAGCGTCCGG
GTTAAACAGGTTCTTGCCGGCGTAGTACATGACGTAGCAACCCACGGCACCGCAGACGGTGGCGATCGTCATGCAAGTAGCCTTCTCCCACAACGGGATC
TTCCTCCAGAACACCTTGACGTAGAAGACGAGTGGCAGGATCAGACTGCACACCgtgatggcggtggcgcCCGTGAAGTCCACCAGGTCGAGGAAGTGGT
CTTTCAGCAGGATCGAGGCCACCGTCAGAATCGCGATCAAAGCGATACGCACCAGAATGTACCGCATCACGTTCACGCCTCCCTTGTATTCGGAGAGGCC
TTCTTTGCTCTTGGTCGCCGACACACGCGCCGCGTCCGGGGCAGTCTGATTGTTGCTCTCAAGGTCAGGGACGGCCGGAGACGACGCGGCGAGGTACgac
atcttctcctcgatctcaACAGCACGGTCCTCATCGTCCGTGGGCAAGGGGTCAACCTTGTGCATGCCCAGCACGAGACGCTCGGCCATGTAGAACGCGG
GGTGGAGGATCGTCGAGAAGGCAATCGACAGGTGGAGCTGCATGAAGATGTACGACATGACCACCGCACCACGGTTGGCAGTGAAACCCAGCGTTGTGGC
GCTGTACGGGTCAGACGTGTTCACGATCGAGAAAAGCAGGTTGCCCGAAAGCTGGCACCCACCGGCGACGTAgccgatgatggcgatggcgaggaagaag
gcaGAGGCCAAGCCGAGgctgacgatgatgacacGGGGCATGCGCTCAGGCTGCGAGTGCTGGCGCTGAAGGTCGGGGATCACAATAGCGGCAGCGTACG
CCAGCGACAGGTTACCGAACGTGGTCAGCACCTGGTGGAACGTCACGTCGGGCGTGGGTGGCGTCGGGTGGCCGCGCTCTTCGTACAGGAGGATGGCAAC
GCCGATAACATCAGCGATGATCGTGCCCAGGCATCCAGCCACAGCCATGCCGGCACtctccttcagcgtcggGATCAGAGCCACAGGGATGACCATGAGC
GCCATGAAAATGATCCAGAACGTCTGGCTGAACGAGTCGGGGAACAGAACGTCGAGCAGTGTGCCACCGAGAACGAGGAACGCGCAAGGGGCAAGCAGAC
ACACGCCCATGTGGGAGACCACCACGAAGAAGCGACCCCACTTGCCGGCAACCCACTCGCCCAAATCGCCGTACGTCTTCACCGAAGCCGGGGCGACCAT
GAGCACCTTGGACAGAAGCACCGTAGCGTAGATGTTGGCGAACGCCATGAACAGCAGGGCGACGGTCGCGTAGCCCCAGCCGGCGCGAGCGTAGTTGGAC
GGCATGCCGAGCGAGCCGATAccgcagatgcagcagaaaatGTTGAACGCGATCTTGGCATCCTCGAGCGTGAAGAAGGCAGAGCGCgtcgatgaggaag
aaggagctgccaTTGTGTTCGTCGCTCAAGAGAGCAAAATGGACAATGAGCCTGGCCGACGGACGTGTGCCGGTGCGTTGACTGGAGAGCGGGCgcaaca
gccagcagcattttccttTGTTTGCGCAAAGTGCTGCCTAGACCACGCGCCCTTCGTCCGTCTACACCCGAGGTTGCTGTTGTCACACTGCACCGGCATT
CAAACGCAGAGCACGACGCGGCCGTTTTTACGTTCGCTGCAAGACGTAGACCAGCGAAAAGATGTTCGCGCaatgcatcagcagctttgCGATCTCTGGA
ACGTAGGCGTTAAACCGctcggcgacggcgacgctcTCCGATGGAGCGCTGCTTTCATTCTTCCGGCGCTAGTGGATCTGATGGCGCCTGGCCAGTCGTT
TTCGCCTGGCAAAATAGCAGTGCATTACTTCAGATCCCGTCACTTGAAACTCATCCCGAAGCATCTCGCGCAGCATCACAGCATGTCGCCGAATACTGTC
GCCGAATGGAGAGCTGCAGACAAAGGTACGGAGC