Description :
From Genome Similarity Track
Location :
Scaffold_405:1311- 3169
Transcript NameFunction/comments
Phymu_g9552palmitoyltransferase, putative

Sequence
1858 bases(100 bases per row)
ATTTTCCCGAGTAAAATACTCAACGATATTGTGCCAATTGTGAAGCAAAAGCCTGACAATGTAACGAGGAAGATCAGGAAGCTTCGATGGTTGCCAATCC
CCACGCAGTTGTTGATCCACGGACAGTGGTGATCGAAACGGTACACGCAGCGCCTGCAGGCCGAGCAGTGCTTCGAGCGTTGAGGCTTGCGAGTGACGCA
CGTTGGACACGGGACGGCGTTATCTTCCGTagccaacagctcgtacGCAGGACGCGTGGAGCGCGGGACGTACCCGGGGTCCTTGATgcacacgtacacg
tacatgatACACGTGAAAGTCAAAAATGCCAGCCCCATGGTCTGATACCGCTCCGCTTCCGTCGGGTTCTGAGAAGACGACAGGCATGGTACTGCAAAAA
TGAGCGACAGGGTCGCTGTGGTTAACACCATTCCAAAAAAGAAAAGAACGGAGGCCCCTTTGCGTGAAGCCCAAGCCACCAGTCGATCCGAAGCGCCAGC
CTTCAACGCGCTTGCAGTGTCAAAGTGCGCACCTTGTCGCGCAATATCCATCGCCGTTCTCCCATGTTTGTCCTTGGCTTTCACAGGTGCGCCTTCAACT
ACAAGCTGCTTGGCCAGGAACGCGTCTCCCAGAGCGCTAGCGATCATGAGCGGCGTCTGTTTCTCCGAATCGCAGATCTTTTGGTTCGCGCCGTACCCGA
CTAGCAGCATCGCGGTGTACTGGAAGCCCTCAAAAACAGCCCAGTGCAAAGCTGTAGCCCCACGGCTGTCTGTCTGGTTTACGTCTGCTCCACGGGATAC
CAGTAGACTCACGAACGCAGCATTGCCTGTACTAGCCGCATAGTGAATCGCTGTCATTCCTGAGGAGTTCATCGCGTCCAAAGACGCCCCAAAGTCGATT
AAAGTAGTCGCGCAAGCCACCGACGTGCACAACATCAACGCCGTCGCGCGGTGCTTGGATTCTCCACAACGACTGTCCAAGAAGTCCTGAAGTGTACCAC
AGGATCGTTCCTGCTCTTGATCTTGCGTCTcagtgctggcgttgctgttggtTTCTTCGTCCATGAGCTCTAGGTCTCCCTTATCCGACGCACATTCCGG
AGCTCCATTGCCGTTCGTGCGTTGTCCGTGCAAGTGAATGTGTCTCTTCTCTGCAGTTCTCATCGTCATCAGGGCGTCTTTATCCTTCGGGAAATACTTC
TTCGCCACCGACACCAGATACGCCACGACCGTCGGGTGTTCGTACAGCACCGCTAGATGCAGAGAGTTCATCTGGTGCCTTGCTTCGTGCACCGTTAAAA
GACGGTAGACGCTCTCCGCTACTCGTCTCCTTGTAGCTTCCGTAACAGTTCGGTCCgtgtgcttctcctcctgcggTTGTTCCTGTCTCTCTACTGCTTT
ACTGATAGCCATCTCCACCGCACTTTGCGCTTGGAAATAGTCTCCTTTCACACAGGCAGAGCCGAGTACTTTGGCGGGAGACGCAAAGTACGAGTATTGA
CTCTCGGtagcctcttcttcgtcgctttgAGGCTCGTCTTCATGCTGTGATAGCAGCGCTGACAAATTGCCGGAACGGGGAGGAGAAGCCGCTTTACAGT
CGTCCTCGGGCTCGTCACTGGGTCTGACAGCGAACGGCGAgaaagcagacgaagacggtgacgacgccGCGTAGCTCGGAGACAACAACGGAGCGCCTGA
GCCCGAGTTCGAACGTGCTAGTCCCGACGGCCCGCCGATCAGCGGCGTCAGCTCTGTCGCCGCATCTttcggagctgctcgcatCTCTCACCTTGTCTGT
GCAGTATATCCGCTTCTGGGCTGCTTGGGTATGGAAATAACGGAGAGAATAGAGAGAA