Description :
From Genome Similarity Track
Location :
Scaffold_444:1311- 3124
Transcript NameFunction/comments
g10773.t1hypothetical protein

Sequence
1813 bases(100 bases per row)
CGACGTACTTCTCGTACATTAAAGTCGTAGGCAAGAAAGAAAGTGGGTGTTGCTTATTTCATGGGCTTAGCAAAACGTGAAGCGAAGCGATAAACCGCAC
TCTTAAAGAATGATCCCATCAGTTGTTCAATGTCGACTGGCTGACAGCAGCCTTCTCTCCAAAACTTAGCAGTAGTAGAGACCGCCGAATGGGATGCCCA
GACCGCAGCCGCCGCCGTACAGACCAGCACCATACATGTTCCAGTAGCCCATCGGGTACGCCCAGCCAGGGTAGCCGCCGCACATGAAGCCGAAGCGGTA
GGGTCCGTAGCCTCCCCAGCCACCCCACCCTCCCCAACCACCAAGCCCCCAGCCACCACCAAGACCGAGACCGAGACCGAGACCACCGACGCCCCAGCCG
AATTGCTCCTTTTTGTCATCCTTGTCGGATTCCTTCATAGCGACAGCTGAAGCGGAAGCAGGTGGGTCTATCTTCTCGGTCGTCCCCGTGAGCGTGACAC
CAGCAGGCAAGTCAGAGGCCTGAATCTTCTCCAGCGCTTCCGCGGGAGTCTTGACGGCACCTTGGTCGACAGTAGCAGCGGTGATCATACCGAGCATGGC
GATGACGGCGAGGAGGAAGACGTTGAACTTCATGGTTGCGTCGGTAGGTTTGGTACTCAACTTGCTTGGTCGGAGGCAAATCGCGTTGTGAAGGCAGCAA
GGTTCATCTCAAAGTGGCGTGACTTGATCCGAGATTTCCAAGTTCTCGCTGACGTAGCGCTGCACTTCAATCTATCACCACGATTGAAGCGTGGCTGTGT
TTTCCCAGCAAGTTATGTTTGTTTCTGTGGTTGGTCATTGGTATCTGCATCACGAGTTTGCATGCAGAAGAGAGACTTCTGTCGTTTTGAGCCGTAGCAT
CCCTGGTCGTGTTAAAATTGAAATAAATGATGAAATTGCTCAAATCGATCGAGCAGAGTCAAAACTATGGACTCAGCTGAGGCTTGTGATGTCGCTGGTA
GAAAACACTTTTGAGTCCCAGGGTGCACAAGGTCGTACCGTGAAGGAAAAAACGTTTTAAGAGAATCGATCCAGCAACACAACCCTGAAAGGTTCGCCAC
CCCGTTCTTGCCGGCGATAGTCATCCACCATTGGTAAATAAAACTGTCTCGCCACTCACTCCCTCCTTTCAAGAAAATGCTTTACAATTGTGAGGGCTTT
GACTACATGAAGTACAACGGACTATACTGCATCCCCGTCGAGACAATTGTGTTCACGGGGTACCTCCTCGACTATGGTAACAACAGCAACGAAGCGTCTT
CTGTGCTCACTCTTCAAACAGTTTTAAATCTTGCGATGGCATTTGAAGCATGAAAGATAAAAAGATAGCTCGTGCAATCCACGCCATCCAAATAACTGAA
CACGATAGCGCAACAATAAACCATTTGGTCAGCTTGAGGCTTGAATTTACTCGCTTCCAAGTTATCAAATACTACAAGGGTTCATTGTTCACTTTAGAAA
AATAGAACGCCATCGTAGACAGCGTTGGAGCTGAATGCGGTACATGAAGAGACCCCGTCTCCAACATATCATATCAGTTTGTTTGCACTATCGACATAAA
ATATGAGAAGCGTCTAGAGTTTGCTAAAATAATACTATTTCTTATGAAAATACCAATAGTCTTTTTTTAATATTCTGCGTTCAAACCGCACTGCTCCAAT
ATTTCTTCTGGAATGCCTGCCAGACAGGTATTGTCTTGCATTTAGTACATAGCAAGTATCATATAATACATGTAGAAAGAGTAGACGGCTTCGTTCTGGG
TCCCAAATGGAAA