Description :
From Genome Similarity Track
Location :
Scaffold_152:13108- 14417
Sequence
1309 bases(100 bases per row)
TACCTCCAGATGTAGGTGTCCGTCATGAAATTGACTTAGTTCCTGGTATTAAATGCTGTATCACACTACAGTTGCCGTTGCCTATAGAGCAATGTGATGC
CATTGATGACTTCTTCCGTGCCAAACACGAGGCAGCAATGGTACGTGAAGATAAATCTCCACATTCGACACCGAAATTTTGTGTCAAAAGCCGAACAGCA
AGTGGCGTATTGTGCATGCTTATACCAAGCTTAATGCGGTTACTATTCCGGAACAGACCCATTTATCGAAAGAATATTCTTTAAAACAATATAGTTGGTT
GTAATATGTGTAGTGCACTCGACTTAGTCGATGTCTATAACCAATTGCTCATGCGATCGCGTGATATTCCGCTCAGCGGTAAGCACTCCTAGTGGTATGC
TCTGGATATGGCTGGTGATGCCGCAAGGGCTGTCGAATGCGCTGGCTAAGTTTAATCGTCTGGTGACGCAACTTTCCGCCCCCATCGGGATTATGCACAG
ACATACTTTGATGAAATTTTTGTCCATAGTTGTGCCGAACAAGGTCGTTTGGATGTTGACAATCACGTCGGGCCCCGTGCGAGCCGTGCTCGACTGTATG
CGCACGAATAAACTGTACGCCAGTGTATCTAATTGCATCTTTGTGCAGAGGAGATTCTTTTTATAGGATATTCATCGGTAAGCGCGGTCTCAGAGCGGAT
ACCGCTAAGGTCAAGGCTATAGTTGAAGAAACAGTTCCTAATAATCAAAAGGACTTACGTAAGTGGCTTGGGCTTGCCAATTACTTACACAAATATAGCG
ATAATTACGCTGATCTGGCTCGGCCATTAGCTAATTTCCTTGAGAAGCACGCATATTGGCGCTGGGATAGCATCCATTTGGACGCATTTCGAGTAGTCAA
GGTGAGTCTCCTCCATGCCCTCATTTTGGCGTTACCAAATTCTGAGTGCATTCTGTGACGCATCCGACTTTGCCTTAGGCAGCGCCCTGTTGCCGAAGGC
CGCGAGCTTGTTGTAGAATTGAAATCTCGTCAGCTGAAAGCTGCTGAAAAGAACTATCCAGTTCATAAAAAAGTGTTACTTGCCATGAAGTATGCTCTCT
TCAATTTAGAGCTCATTTACTTGGCTTCAAGCCTTTCGTCGTCTACACGGATCATCCGTCATCACGCACGCGACACAGTCGCCTCACCTATCTCAAAGAA
ATGCTCGTTGTATATCCTTCTTTACAGAATATAACTTCGAGGTGAAGTATAAACCGGGCAAACAGAATGTGCTAGCATATGAACTCCTTCGCCGACCTGA
CAATGAGAT