Description :
From Genome Similarity Track
Location :
Scaffold_117:13106- 15149
Sequence
2043 bases(100 bases per row)
TCACCGAAAGAAGTCCTGTACTGATAGTACGGCCTATGGCGACCGACGTAGTGCGTAGGATGAGTGCACATTTTTCGTGGAAGTTCAATCGTATACGCGT
TGGCTAGGCGGCGCAGCACACGAAATGGACTGATGAACTTGGCTAGTAACTTGTTACTTCCCACGTTAGTCACTATGTGTCGAGGTAGGTTTACCGTAGA
TAGTACGGCTAAGTCGCCATTATTAAATAAAATAACGTTTGCCCTTCCATTCTTGTCAGCGTTTCGTTTTTTTCGATCTACCGCCTCTGCAATCGAGTGT
TGTAAGAAACGGACAACCGTTTCACTAGCCAGAATTAATTCATCTGCTGACTCGCTGTCTTTAGCTGCAGTGCTCTTGGAGAGTACTGTAGCAAGATCGC
TTGTCGCCTCTGTGAGCGTGTCTTTGGACGCATTAGGCGTGATACTGATTTGATCAGCATCGTGACCAGTAAGAGCATCTTCGCTCTTACTTTCCTCTTC
TTCACCAAAGCCGATGTGATCTACATCGGAGTCGAACGTGGTGGCCGCGTTGTCAGCACGTGACGAGTGAGAGCCGAATTGACGGTCGCTCGATTGAGTC
CCTTCCCCCCTTAAACGAGAGTCACACTCTAAAAGGTGGGATGACGCGGATGGCGCAGGTCATTCACGAAGAACGGTGTATGCGTTTTCGACGCATGCAC
CCAGTTGTTGATGGCTAATTCCAACATCGGCAAGAATTCGCTCCAATTTGAAAGGTATTGAAGATACCCTCGAAGTAATTCTCCGAGAATACGATTGGCG
CGTCACGTCTGACCATTTGTTTCAGGGTGGTCAGACGTGGACATCTTTAAGCGCGTTCCGAGTGTTTTGAACACGGAACGCCAGAACTCAGCTGTGAACC
GCGGGTCCTGATTGGACTAGAGTTCACGAAGAAACCTATGAAGGCGAAAGACCGTGTCGATAACGACACGAGCACAAGCCAATGAGTTGATTGATTCAGG
TACAGCAACCAGATGTACCATCTTGCTGAAGCGGTCAATGAACACAAGAATACCAGTGTTCTTGTGAGAGTCTGCGGGGAATTAAAAGACAAAGTCCATG
GAAACGGATTTCCAGCACTCTGTCGGGACGGGTAGAGGCTGCAACGATGCATGAAGGGAAGGACTAGACTTCACCCTTTGGCAGACCCCACAGGCCCGAA
TGTACTTGCACACGAACTGATACTGGCGGATCCAGTAGAAGTCGCGGCTCACTGTGAGATATGTTTTCTCACGACCACGATGTCCACCAACAAGTGCGTC
GTGGTACATATACATGATACGCAATCACAGATCACCGTGATCTGGTACGACGACACGAGGCGTGTCGCCGGTAACAGCCGAACATTGGAGTTGGCCGTTG
CGAACTGTACATCCATCCGTAGAGGATCGATACACTAACGACAACTGTTTGAGGTTCTTCATGGATGGTTGCATGATGATAAGTCAATCGCACCATCTCC
GGATCATACGCCTTTCGTATATCCTCCAAAGGTTGACGACGGGACACTCGAAGTCAGTACCACGACAGTGGTCGTACCAGTGTCGGGTGGCGCAGCCGGA
TCGAAATAGGGCCGGCGCGAGCGTGCGTCAGCGACGACATTAAGTCGTCCTGGCCTATACTCGACGGAGAAGTTGTACTCCGCAAATAATGACAGCCATT
CGCCATTCGCTGCACGAGGAGTGGACTGTTTCCGGCCGTGCGTAAAGACGCATGGTCCGTAAAAACGATGAAGCGTCTATCACCTAGCAGATAGACTCTA
AGCTTAACCAGCACGTACTTCATGGCAAGGTGTTCCTTGTCACTGAAGGGGTAGTTGCGTTCAGCTGGTTGCAGCTGGTGAGTCTGGTAACAGACGACAC
GCGCCACATCATCTGCATCGTACTGCATTAATGCACAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGG