Description :
From Genome Similarity Track
Location :
Scaffold_121:13101- 34215
Transcript NameFunction/comments
Phypl_g3590hypothetical protein
Phypl_g3591hypothetical protein
Phypl_g3592peroxisomal multifunctional enzyme, putative
Phypl_g3593hypothetical protein PHYSODRAFT_353725
Phypl_g3594hypothetical protein
Phypl_g3595hypothetical protein

Sequence
21114 bases(100 bases per row)
TCCGGACAGCGAGTGGCCTGTCATATCTATtgtggatgacgacgactaTGACACGCAGGAGATATGTGAAGATGTCGGTGAAGCCTGATAAAGCTAAGCG
TCTATCTTATCGATGAATCGTTGGCTGTAAAGGCCACTAGAGCATCCGTGTGAGTTGAAGTGTTTGGGAGGGAAGGAGGCCAACCTGAAAAAAAATCTTT
CTGTATCTAGGATACAGAAACGGAACGTGTGACAAGTTGACGACGGTGGTAGTACTTACGGAGGCTGACACATGCAAGTTTCAGCGAGCGCAAGTGCCAT
CGATATACGCTGGCTGACGGGATGGTTTAACAGTAAGGAGGTTGCACATCCATAGCAAATCAAAATGATACTTATGTTTCCAGAAAAAAGGTGCATCATT
CAAATCACAACAGGAAAAGGAGAATTTCATTGCGTACGAAATGAATCAGACGATAATAGCACAACTGATGGATATGCCACACTTTTTGGCTtataaaaaa
aataaactTTTTTTTGGCCCGAGATATCGTTTTGGCCTCTCATTACGAAAAAACTGATTAGACAAGCTGGGGTTGACAAGGCTTAACGCGATCCCAAGGC
GCTGATCTTCACCGTGGTGTGCTTCGTTTCGAAAGTAATTAAATGCACATTAGTATCACTTTGTATGACCGGGCCTCATTATAACGAATTTTATAACAGC
TCATAAACTGTACGATCACAACTCATTTAGGCTTACAAAAATCTAGCTGTATTATTCTCTCTGTTATACGTCCTCCGGTTGGAAATAAGTGCAACAAAAA
AACAGCTGGCATTGCTAATTTTCCTCAGCGGCTCGCTTTACGCACGTTAATTGGTGTAATCGACGCGGGTTGATCCCAGCTTTTCAATGCTGGTTTGAGC
GCCAAAAAATTCCCACAAACGCGGGAGTTACGACCAAAAGAAGGCGGAGCGACCCCCTTCACGGCACTCTCTGTCCGGATCTTGCTATCACTTACGGAAG
CACCATTTACACTCTTCTCAAGCCAAGCCCACCATCGTTCCGCCATGAACGTTAATTCCAAGTCGAACACGTCGACAATAGAGCGCCAAGACGTTGTGCT
CTTCATGCTCATGCACAGCGCGCTGGACTGGGGGGCGatggaagatgctgccgaGCATTTTGGCGTTGAtagcagcaccaccagccaCATTTGGGCGCTG
TTCAAGCGGATGCGAGTCTCTCAAGGCATGGATGGGGTGGTCAGCAAGAAGGCGGGGGTGTGCGGCCGCAAGAAATTGGATCGCTCCTCGTTGCTTAAGC
GCATCGCCGCTCTGCCCTTGCTCCGACGCATGACGTAGCAATGCACGGCTGAAGAGCTGGGCATTTCGCACTCCGTCACTCGCGACGCCATCGCTCAAGG
ctagctgctgcaccactCAAGCACCATCCATCCCCTTCTCACCAAGCAGAACAAGAACGCTAGTCTGCGGCATGCCATCAAAAACGCCGTGCACGGCCAG
GAAGTCTCCCACTTCTCGCCCATGTGCATGTGGACGAGAAGTGGTTTAACCaggacaaggacaagaaggtgTTCTACATACTGCCAGGCGAGACAGTGTC
TCACCGTGAGTGGAAAAACAAACGGTTTATTGGCAAGGCCATGTTCCTGGCTGCTGTAGCTAGACCAAGGTACGCCCCCCCCNccccccccccccccact
aCTTTCTGTCCTTATCGAAACCTTTAACTGTTTATATTTCCTTTTTTAAGGTATGATGGTAATGGACAGGTTATTTTTGACGGGAAGATATAATTCGGGT
TTTTTACAAACCAAGTCGTCGCCCAGCGTTCAAGCTGCAACCGCCTTGCAGGCACCGTCGAAACCAAGAACCTGGACACGGTTAATCGAGTCGTGTACAA
GCACACCCTTTCTGCAGCATGTTATTCCGTCTATCAAAGCGAAATGGCCCTCGGCGGATCAGCACAAACCCATCTACATCCAGCAGGATAACgcgacccc
ccccccccccgtctCTCCTGATGATCCAGACATTCGGGCAGCCGGATCAGCGGGTGGCTGGAACATTCAGTTCATGTTTCAGCCGCTAAACTCACCTGAC
ATGAACGAATTGGACCTAGGCTACTTCTTATCTATCCAGGCCCTTCAGTACCAGGAAGATTGCTACAATATCGACCAGTTTCTCGCAGCAGTACGGAAGT
CGTATGCAGCGCTGGTTCCAGAGAAGCTGAACAATATTTTCCTGACGTTGCAGCGGGTATTGGAGTGCGTGATACGGGTAGGAGGCGGGAACGACTACAA
GGTACCTTATTCCGGCAAGGCCAAACTACGAAGAAATGGAAGACTCCCCCAATCTTTTGTGTACGACTTAGCTCTCTTTCGATATGCCGTCGCGCTCATC
CACGAAGACGTTGTTATAAGTGTATAGCAGGTTTTTCTTATGTTTATATTGTGGTTTTCGTCTAAATTTGCCGTTTTGGGGCGGTTGGTGGAATCGCTCa
catacaaattcaagtcattagTGGAATCGCGCAAGCAGTaaaacagctgttcttgTCAAGACTagattcgtacttaatggGCATATATACAAGATTGTAT
ACGCTTGCGCGAATGCCTGCGCGGTTGATTCGAAGAACCGCGCAAGGAAATTTTGAGTAAAAAGCACAATACCTCGTGAATATAATATATTTACCATATC
AAGTTTCGAAGTACCCGACGGAGTGAAAAGGCTATTCTTGCACTCTTTCAAACCCGGAGGAAGTAGGCGTCACGTATGTACCTGTCCAGGTTAGGGTTAC
GAGGTCCTGCCAATTTGTGCTATACTCGAACTTAGTAAAGTGAATTAGGTGGAAAGTCTCTTGCCATTTTCGACCAAGTCACTGGGGCGCCGAGCCTGCC
ATTTCCTTGCCAGTCGCTGAGGCGTTAGCCCCGAGACTTGGGGCCCTGCTACACTAGTACGTTGTGACACGAGGCTGAGCGGGATTTTCTCCCTGAAGTC
ATAAACTGTCGACTGACGTGATGAATTCCTGGCTTCTGATTGGCCAGCAGAGACATTAGACCCGGCTGTACGCGGACTTCTGCTGGGTTCCGCGGAAcga
ggtggccacggcctAGGATGGACCTTTAAGGCTTGAAAGGCTGCGTTCAAGAAGATAATCGTTgaacgcagcagctccgtccaaCCCACCACCGTCCTCA
AGCGGGTTGACCCCAAGGGGAATCGAAACCACCTGTCTGAATTTATTGTACGAAGTGTCTCGCCTCGCCTAGATTCCGGTTGTACATCAATATCGTGCAC
CCGGAACTTGCCAAATCCAATAACGCCATACATACTGTGTACAGACCGCTGGCCCCCTGATTCTAATGATCAAGTTCTGAATCTACGCACGTATGAGCCT
CTAAAATACGTCAATCCTTGGCCGCAAGGCCATGACCGCCCTTTAGTTCTTGGATGCAGAATGTCCTCGAACGGAGATTCCTGAACACACGTTGTGCTGA
AGGAATAGCGCACTCTGGATCCCATACAAGCCGGTTTCAAGGAATATCTGAGTTCAAGACCCTTGCCCGCACTGAGGCCAAGGATTCTCCAGAACTGCGA
CCAAGGTTTCCAGAAGCCAGTTCTTGCCTTAGAAATGGCACCTTGAAGCTGGAAAATATCCCCATGATGGTGTTGACGTCAACAAATCTGTCGACGTCAG
CACCAAATATACTCAAGTTACGTCAGTGCCAGACGTGAAGCCAAGGAACACCAAAGGATACCGAATAACACCAAAGAAGGATAGTCTTTACATGTAGCCA
GCAGATCGCTAGCAGATAACGATAACAGAGTCCGTTTTACCCCCTTCTGCGTAAGTCGATTGAGTCTGCGAACAAGAGTCCGGGTCCGCTGTTACATAAG
CCAGGCCAGAGCGGGGCTCCAGAGACACTTAAGTCCAGTTGCGTTGGGGATCATTTGCGTCAGCGTCTGAAGTGATCCGTGCATTCCATATCCTAGTTGG
ACCCATTGCGTGATAAGGTAGGGTGGGGTTCCCATTTCATGTTACTTGAACCTTGGGGTGATTGGATAGCAATTGTCCCCCGAGCGTATAATTAACTGCG
TTTAAGCCTGTCAATCAGGGTGCGTTCAGGGTCGGTTTGTATCGAATTGTGTATATTTCCCTCATCCGTGGGTGGTGCGCGTGGAAAGGAGAAAGGGTtg
accagcaccttgagcttggcccTAAGTTGACTGGTTTCAGGCCCTATACGTTCCAGGGCCAAGAGTAAGGAACGTTTTAGTGTTGAATATAACTCTGGAT
TGTAGTGTTATCGGAAAGAGGTGTGTTTTGGCTGGCGTGTTAACCGCGTTTAATCTTTTGCGTAGTGCGTTCAAGATGTGGACGGTGCGCTCAACACTCT
CAAAACCTACTTGCGCTACAGCAACTCACTAAGTGACCGATCCAGGCTCCTCGAAGATAAACGGCACCGATACGGATTGCCACGTCCTTAGCACTGCGTC
CAAGAACTTGCGTCCAAGGATCTGCGTTCAGGGATACCTTCCCAGTCAGTCATCAGTcagagctgctgctttaCACCTGGGCGAAAAATGTTCACCGATC
GCGTCAAAACGTTGGCTAGCTGCTTGTGCAATTTAGCTGCCGTGGTGTGTGTGGGGGCTAATTTACGCGTGTCGTGCTTTTCTTGACTATGGAAATTACA
ATAGGGACGGCGATTGGATCCGTACTGTAGAAGTGTAGACATATTCAGCTTTAAACGATTCAACAATCATCCTCGCTGTCGCAACTACTAATTTCATCGT
CGCTGTGCACTGTGCAAGTGTCATCGCTAGAGTCAATTTgaggacgagcgcgtgcttgCCGAGTGACCATTTGTCGCGAAAGCGTCTCATGATCTCGATA
CTTGAAGTAGTTATctgcgagcgagcgagcaaTTTTGCGAGTGAGAAGTCACCTAGCCTACCAACCAGTCCAGATCACTTATTCTTCTGGGGAGAGACTT
GACGTACGGAAAATCTGATATCCCTACGGATATCTTGTCTTCCGTAACGCAAGACATATTCATGGGCAAATGGGGGCATGTTTGGCCTCACCGGTCCTAC
CTGAGGGCGCGGTAAGCGCCCCAATGAGATCAATCAATGCTTGCCGCGGGCTTTTGCATGGGCACCAGCTAAGGACCTCTGTTTTGGTACGCTACCCCAT
CATGATGAGGGTATCCGTCAAAAGACCAGCTTTGGCGAATCGGCTGACGATTACCTCTGTCGTCAAGGCTCCCCAAGCTTCTACAATCCATTCAGCGACC
TGTGGGCGCATTGCAGTTTACAGCTCAAAACTGGCGTGCTTGAATCGCCGCTTCCGGCGGCAAGGCACCATGGCTTCGTTGCGCACGCTGTCGTCATCAC
GCGGCGTTTCAGATACACTGATTTGCCAAGCGCGGGATCCGCCCAGGAGTGCCCAGATTTCCAATCTTCGCCCTatctgcggctgcagcaccgtcttgTT
CCTTCTCCTCTGCCAGTCTCTCTACTGTATATTCCTCGTGGTACTTGGCAATCCCCTCTTGAAGATGTGCTACATAGTGTGGTGGaatggagaaggagcg
agCTACAGCAATGCTGCTGGTAGATTCGAAAGGAAACAAATATCCTCCGTTTCTCGAGTACAAGAGCGCTCCAGTAAAAACAGCAGAAGCAAGAGCTAAA
AACAAGTCGCAACGTCATGGGTTTACGCGCCGAGTATGGAAGGAGATCAGCGCCCCAGACGCCGCACACGGCCGAGTCGAGGAACTTACCGTAAGGAGAA
AGGGGGTGGGGCGGGACACTAAGCGGCGCCCCACAAAcgaagcgagagaggggcaggcctcgcgctgctccgtcgATATGTTCGCATATTGTAATTAAGT
CTTCTGTGTAATGAGAGTATGACGGAAATTTTGAGACAATTAGAACAGTATTGGACTGCATATGTACGCATAACACTACATCGGTTGCCAGACTTGTATT
GACGTCCGGAATCAAATAAATACGGAGGCACCCGCGCCCGTGTTTCTCCTGGGTGCACCAATACCGATATTCCTAATCGTTGACCCTGCCTGCAGGAAAT
CCAGGAGGTGGCATTTGAGCTTTGGtgctgccccccccccacttGTCCAACCGCGGCGAACGTACAGGAAAGCACTGTTTAGATGGTAGTACTGTCAATT
TCAGAtgttctctggatttcaATTCAGAGTTGTTACAGTGATCTCACCGGGAGGTCTGACTGTATTCGTTGTAACTCAATACACATCGAAAACGATGCAT
GTCATGATAAACACTCCTTCGTGCAACATGAAAAAGTATATTTCAAAACGCAGTACACGACTTTTACCGATGTGCTACAGAACTTCAAACATTCAAGCTT
TGAGCGCCGTCCCAGGTGCAGGTCGCCCATGTCATTTGACCAAAGAATTATATCAAACCAAGAAACCGAAGCCCGTACCGTGGTTCTTGATCTTGTTGCA
TACAACTATAGCGCTCCCAAATACAGCACTAATGTTTTGTTGGGACTGTTCCCAGCTACACGACTGTACCATATAtccttctgctgcacgagcttTACCA
CTTTTTTTTGTCTGTAAAAATATTGAGAACGCTATTAGTAGGGAGTAGAAGTTCTTCATGGGTAGACTAGTTACTTGTGAGAGAAATGAATGCGTCTTGT
CTAGGGCATCGATGCTCAGGTCTGTTGACACGAGAAATTCGTTGAAAACAGCTAGCTCCTGCCCGACAGTATCAGCAGGCGCGCTGAACCCCCGATGTGC
TCCTCTCATTGTGCTTCACTACCAGTCAGGCTAAACTACACCTTTTACCAGGCAGACTGACCTTTTTCACAAGCAAGCCGATCATTCAAGGTTAGACAAA
AACAAAACTAAAACAAGGTTTTACAAGTAAAGTAGTTTGGCGCAATATTCTTCCCTGTCAAATTGGTTCGGTGGCTGAAAACAACACCAGCCATTCAGCT
CCGGCACCACtgtcctccaccaccgcgCGAGCATTCTCTCATTTGGCATTGGCTCTCTTGCGGCACTCCACCCGCAGCTGTTCCCCCCACAATGGCCCCG
CAGCCTGCGCCCTCGACGATGATTCCGCAGACGCCGCCCCTCATACCACGTGGGGTCAAGCAATACGAGCGCaccagcgcgaagaagcgcgtgctcgacg
ccTGCTTGGCCGGTCAAGACTGGCTCGGAGTCGCTACCAGCAATGCCGTGTCCGTCAGTACTGCTCGTCGCATTGTCGCGATACGCAGTATtaagcagca
gccacgagtTGGCGTGAGGTACTCGTGCGTGGAGATGACGGTCGAGGTCAtgtccaagctcgaggagtaCTTGGACGAGCAGGCGGACATGGCCATGGCC
GTCATGAAGGACATGCTGCTGAGTGACATCACGGTGGACGTGAGAATTTCCTCCATCCACTGCGCGCTGTACGACATGCTCTACAAGGTCAAGGGTCTCC
GAATCGAGAAAGCCACCGACGCCGTgaacaaggagaagctgctggcgtttgCCAAGGCGCTGAACAATCATGTGTCCGCTGGGGAATATGTCCCGCCGTC
CAAGGGCAAGAATCTCCACGTGCAGTACGGCGTGTCGCCCGCCAATGGCCTCGCGTTGCTGTGCAGGCACGAGGGCTCCATCCGCATGGAGGAGAACGTG
CGGTTCGTCGCAGATTTTTTGTGGCCGCCCTCAACACGGACGCGTACAAGGAGTGCTGTGTCGACAAGAATGTTGTCGTGATCACGGACAACACTCCTGC
CCACAGCCAAGTGGGGACACTCGCATGTGAGCAGCTTATTGCTGGCGGAATtgtcaacagcagcaagctggtCATTGTACGCCTAGCGACGTACAGCCCG
ACCTGCAACTCAGTCGAGGGCTGTTTCAAAGCGCTGAAAGCGCGCAggaaacagcagcttgcagctaAGCGACGTGAGCTGCTTGTGCGAGGCGAGTATg
agtcgctggctgcgcacATAATGTCCCTAATGAAGGAGGCCGTAGCACTGAGCAAGGGGGTCTTGATGCAGCGATTGGTTTGGCGCATGGAACGACACTG
TTTAAAAGCATTTTTATGGCCGAACGTGGCGAAGAAATGGAGCTAGGTAAGTAGGGTTGGTAACAACCACTTTGCTTGGTAAAACAATATCAGAAAACCA
GTTTGCCTTGGAAGTATCCTTTTACGCTGAATTATTAAGTTGCATGAGCACGCCAAGACCGTTTTGCGCGTGAAAAAGGTCAGTCTGTCTGGTGGAAGGT
GTAGAATGCGCCTTACTACGAGCGCCACGATCTATATTTGTCAGATGATAAAACCACTGTCTTCAATGTGAAGGTATATTCCGCCACAGTTTGCAGTTAG
GCCCTGGTTCAGGTGCCAGCATGCGTTCTGTGCTGGAATGTTTAAGGGATCTTATTGGTCAAAATATATAAGGTACTACGTACCATTTGTTTTAGGTTTC
GTGTTCcgacacgctgctgttcaGTCTGGACACACAAAGGTGTTTTGACTGGAGCACAACAGTACTGCGGAGCCCCTACCTTCGTTTCCATTCATTTCAA
AGCTTGTCATCACCGCCGGATGGATGCTGAAGCCGTTCCTGTCACCGTAGTGATGCTTTGCGCCTGCGCTGTAGTAACTACGGCGGCTTCGATAGACAAG
CGCAGCAATAAACAGCCGCCCTCCATCGTCTCCACCTTCCCAACCACCACGTTTGAAGACGCTCGTAGTGGTCTATATTAATGATTGTTTGAGTACCCTC
AGCACCATGGCAGCCACGTATGTAGTTAAATGCGGCAAGTAGAAGATAGTTTATTTGCTGTGGCAGTCTTACCAGGGGTAATAGGAGCCGTGGACGGTAC
GCTCAttgcgccacctcgtcctcatTACTTTGAGGGCTGGTACTGCCGCAAAGGGCTTCCTGCTGTGAACGTTCAAGTCATTGTCGACCGCCGTGAAGCG
TTTCGTTCCTTTTCTATTCGCTCGGGCTCCAACAATGACCAGTCTCTATGGAACGGCAGAAAGTGGAATCGTCTAATGTTGTTTAACGTCGAACTACCCA
GCTCTGACCCGTGTTAAATTGTGCAAGGCGGGCTATAAGTCTACCCGAGTTTGTTCATCCAGGAAAACCATTACTCACGGATGCATAGTACAAGATCTGG
GCACATTAACCCACCTCTTTGTCAGAGTCAGAGGCGATTGCTGATCGCCGGAAGCGCGTCTACAACCGTCTACATTCGCGCACACGAGTGGCTGTTGAGT
GTTCTTACGGAATTGCGAAGAGTACCTTCAGCATTTTACTGGGTAAGATGGAGCAGAAAACACCACAACGCATCTGCAAAGTCATGTACAGCTGTGCGGT
GCTCCACAACATGTCGCTGCGCGTAAAGGACGGTCAGAATGTTAATAGTAGCGATCCGCTCCCTGCACGCAATAATCACCGCGGAGGTGAAGGCGGACCG
AGAACATTCAAGCGACCATTTTCAAAAAGACTTGGGGTCGCAAAGAGAAACGATTTAGCATATATATTTGTGTAGTAGACTCTAATGTAATAACATAGTC
AATTGGTTCTGGGGTTAAGTTGTATTACGTTGTGTTACACCTCGCGTTGAGCAATTagctggtgcagcaactggaacTGTAACGCCTGGAAACAGCTCgt
ctcgtcgtgctgccgtTCAAGTGTCGCTATGAGACGTCTAATCAGATCGGCGGAAGGACTTGCGCAGAGAGTGACGTTGCTAAAGCCTCCATATCAGTCT
ACATGGCCGTACCTAGGTTCTCGACTGGGGTTGCTTTGCCTTTCGACGTCGCAATGATAGGCTCGTCTGCGGGGCCGGCATCACGACTTCCAGCTGGGGT
tacgtcgccatcgtcgtcgtccaaaTGGGAGTCTAGCAACTCCTCCTCACTTATGCTAACCCTTCACGAGAAGGCACCACGTAAAAATGCCCGCAATCGC
ATCATCTATTTCCCGCAGTTCGCACGCGCAGTTGCCAGTTCGTCCTTCCTCCCGTTTCTCCTGTCGGTATATGCATTGCAGTTTCCTATACTTCTGCGAA
GTCTAGTGAACATACCATCAATAGTTAGAACAGCGTTAATATCATATTGTAAAAAAACAAATGATAACATACATGTTCGCGGGTGATGACCACGCCCAGC
GACTGCGACAGCACGCTTGCAAAGAGTTGCTAAGCAAGCGCAGTTTGCGTCTTAGTCTGAGCAACCTCTAGGTGGCTCTTGATCTCTCCATTCGCAAAGC
AGGGCCTCAGAAGCGCAGCTGCCATTTAATTAGACCACTTGAAGCGCTTGTCCGCTTTGGATCTTCTAATGGGGGTGCCGGACAATGCTTACCGCGAAGA
AAACTGGCCAGATGCTCTGCTGGGGTGTCCGAGCCATATATATCCGCCGAAAAACCAGCGCCACAAGAGTGGTTGCCCGCTGCGTTGTCTTCTCCGTCCA
TCCAAATGTCAAACGAAGAGGTTCGTGGTTGGACAAGCTATCGTTGGCTATATGATCATCGGTTAGAGAAGGTGCGGCACACGGCTGTCGCAGCCAGAAC
ACACTAATACGTCCCTACCCTCCACCGGCAGTCCTGCCGGAATTGCTGCTCAACATACAGTGCTGGCTCCTAAACCAGGGCATTATCCAATAAACTGATG
TGTATGTTGGTTTCAGTATGGCAACTTATTGTCAAAATTAGTAGAACGACGGGTAATTCCGAAAATAAGTTGGAATATGATAGATCTACCTCTAAGTGGG
TGTGATTGGACAAATATGAAGTATCGACGCATATATATTGGCTATAGGGGAGGATAACCCTATAAGAAGGGAATTGGGTCTCTGTACCAAATATACTTAT
ACATATACTACAGATGCACCTCCCTTAGCTAATACAGCTCGTGGTTGTGTGGTACACATTACCTAAAATCGGACGATACGAGCAAAAATATTAAATTTTT
CAGAGatatgaaaatgtcagctGGTAACCAAAGCTACAGCCGAATGCTTTTTTGGAGCTCGATTTTACACGAATATTTCTTGGAATAGATGCACAGGCAT
TTTGGTGCGCTGACTGCTTGATTGTAGCTCTGTTTTTCATTATATGCTTGGTTTTTGCCTCAAATGACGCTTTGGGGTTATCATCAGAACttatcaagtt
tcaagttaGACAGAATTATCATGGCTCCATACAAAAAGCATGTCTACGGGGACGGTGGACCCAACAATAATATCAAGTACGCCAGGATATCATCCTATAC
AAGCTCACCTTAGACAGGTTCATCTGTTCAGTAATTGGCAGATTCCGGACGAAAGGCATGAATAGAGCCACACCAGTCAGACATTAAAAAAATCTCTCCA
ATCAACGGCGACTTATCCATTCCGGACAGAGGGTAAATCGTATTTTGTCAAATATGTAAATACTCGACCActcgtcgttctcctcaTTCAGCGTTTTTTT
CGTCCAGGCGACAGCGGCACGGCGGAGAGCGGCGCGGGGAAAGGCGGTGCGCGGCGCAGAGGACGGCAGCGCGACGGATGGCGGCGGATCTCTGCGAGGT
AGGCTTCATCtcccccacacacacacccctcatacacacacacactcaCTCACGCTAGTGTAGCTCGGTGGTAGAGTGGGAAGATTTGTCGCTATCTGTG
TCGCAAATGTGATGTTGAATGTATTGGTGGCTGTGTagaggaggaggcccagACTGCTAGGCTAGGTCGCTGGCGGTCCACTGATGCGACGGACGTGTAT
ACGAGTCGACGATAGCCCCGTTGGCCTTCAACGCAAGGTACTATGTCCCAAGAGACTGGTACGCCGCCGGATGCGAAGCTCGCAGCTCTCTCCAGCGCTT
GCGAAGTGACGAAGCCTTTGTGGATTACTTCCTACCGTCGATTGAGTGCAGACGCTCGATTGCAGTGCGGTCAAGCGCGAGACCAAGGTCTCACCAgagc
gtgtgcttccagACTCGGTATGTGTCGGCGTCAGCTCGGTGATTATGCCTGGTGCCTGGTACAGTACGAGCATGACATTGACGGCTGCTTTTGCATCTGT
TCATTTGTTTTGTTCGCGCTTACCCTTAACGGTTTCCAAGATCCGGTTTGTGAACAAGTTCAGCACACAGTCTCCAAGagttgatgccgtcgctAGAGCT
GGAAGTGCATCAGAAGACAGCGACAGGGAAGCAGCTTGTGTTGTTGCCGAAATATACGCGTCCGGTACGACAGCAGGTGACGTATATACTGTGTCTTCTA
GTCAAGTTAGTCTATCATTTATTTGAGCTAACTGCTTGAGCATGTTTTCCATTGTTGACGCAAAAAGTGTGTCTCGACCTGTGACAGCATTGCTGACTTG
GGCATGGTTGTGGTTTGCCAGCGTACTGTGAGGTGTTCACCCCAATCGAAGCATGTTGTGGTACTGATATGACAGCCAAGTCgtggcggcgacagctcga
TGGAGCTGATACTCGTACCATGTGAGCTGTACGGCGCTGCCGCGGCAGGACTCGAGTACGCTCTTCATATGCATCAGCAAAGCCGCGGACGTGGcatcga
cgacagcgagagGCACGTTGTGTAGCGCGTCTGGAGACccaaggacgtgctggtACAGCTCGTCACGGAGGGTTAGCAGCTGTCCGTACTCTGCAATTGa
gagccgctgctgcagatctcCGGTAGTTGGTGTCGATCCAGGTAAGTCGGGAGCTTTAAATCCAGCTAGTACTCTGGTCCTCACGCGTGGTTGTGCCTAT
GTATGCGAAGGCCTTCGTGAGCGATTCAAGCAGCCAGGCCCCCTGGTAGAGATCCATCGAATGGCCTGCTTAGGAGACGCGTTAGCGTAAGCTGGTGAGC
CCCGTCTGAGTGAGTGACTGGTCGTGTTTGGAGTCACAGCTTGCTGCCGCGAAGGTgccatctccatcaacgCGTCGCGGATAACTTCGGAAATATAGCT
TGCGACGTTGGGGTGCTTGCGCTCTCATTTTGTTGCTGGTGTTCACTCGCTATCGATGTCAGTTGAAGGTTCTCCCAGTATATCACAGCTTCCTCTTGCG
TGTATGTCTACCCTCCAGGCAGATCCGACACTGAGTATCTTGGTACGAGAGGAAACACATACTCCGACGGCTCATCATGACACACGAAGAGCACATCGAA
AGTGTGCAGCATGCACTGCTGTCAATGTTCTGGTGCTTTGTAGATTGACACACCCTGCACAACCGAGGTTTTAATACGCGCAATCCTCAGAAACAGCTCA
CCTGACGGTGCTAGCGATAGTTGCTGCTTTCGCGCAAAGCAAGTGTCAACAGCCCTCCCAAACGTATGCGACATCATCGCCAAAAGGACTGCATCATGTA
CGGATTTGAGCCCGGTGGCAACATCTCCATGTATGACTAAGTGCTCCACCAAGAAACACAGATCGTGTATAGTGCAGCCAGGTGCATCATTTGTCTGGAC
GATCGCGCGGAGATTGCATTCCTCAATCGAGCTGGCCATTTTGTCTCGAATCTTGGCAATTCGCTTTGAGTCGGTTAGGTCATCCTTATAacgctcacgc
agcaggtTGATAACTTGAGAGAAGCAGCCGAGTGCAGTTGACTTAGCTAGAAAaccatcagcagcacggctTTGTCACTTTTCTTTGTCTGTAAGGAGAT
TGAAAACGCTGTTAGTAGTGAATAGAACTTCTGCATGGGCAAGCTACCCTGCTGAGAAAGTGAGGAATGCATCCTTTCTAAACTATCACTGCTTAGTTCA
GCAGAATCTAGGAACTCGTTGAAAACCTTAACTGGAGCGACCACTTGCCCCAGCGTACCAGCCGGCGTGTCAAGACCACGAGGTGCTCTCCTCATCGTGC
TTCCCACTCGTCATCTTGGCTAGAATGACTCTTGGCACGGCTTGTCTTGGTCTCGCATGCAACCACTTCGACGGGAGGTTATTTCCGGAACAAATCACAA
TTATCCGGTAAGATTGCATTTGTCGTGGTGCCAGTATGGTGACTTATTTTCAGATTTCGAGGTGCGGCGGACAATTCCAGAAATAAGCTGGAATGGGTGG
TACCTACCCCTAATTAGCCTTGATTGGTTGTATATGCGATGTGATCGATCTTGATGAATATTCATTGGCTGCCGTTGGGATACTATTATAATAGGGCTTG
GGTATCCGTACCAAATAGACTTATCCTACAATAAATAAAATAAATTTGGAACGTCCTCTGCATGCGTAAACCGATGACGTAAAACGATAAGTTCAACGCC
GCAAACGTATGGCCTTCAGTATTACCGACGTAGAACATTATAGCCTTCCCAATCGGACCACTTCAAGTCTCATTTGGAACGGATACAATCTGTTTATAAA
CATACCTTGCTTAAACAGCTAAACTAAATAGTATACCTATTTTTTTGCTTTTTTCGGTACTGCTTATCACTAGCACCGTCGAAGCTTCACATCGCAAATT
TGCGCCGACAGCTCACGTCGTTTCCCGCCCACTTCAAGCTCTCACCTCAACACCATGCTTCGCTTCGACGACCAGGTCGCTATCGTCACCGGCTCCGGCG
CCGGAATCGGCCGCTGctacgcgctgctcttcgccgagcgcggcgccaaaGTGTACGTTGACTCTTGGTTGCCGTTGTCACCTCTCTCTCTGCATCTATC
TAACCCTTGCTACTGCTCTACGCCAGTGTGGTGAACGACTTCAGCCGAGAGGCGGCGGACTCGGTGGTCAATGAAATCAAGGCCAAGGGTGCGTGGGTGT
GAGGCCTGTTGAGCAGAGGAGCACATGTGCGGTTGATGATGGGCGCTAACTGTTTGACTGTTCCTTCATGTATGGTAGGCGGTGTCGCGGTGGCCAACTA
CAACTCAGTGACGGACGGTgagaaggtggtggccacTGCCATCGAGAACTTTGGCCGTGTGGACATTCTGGTGAACAACGCCGGCATCCTGCGCGACGTA
ACCTTCGCCAAGATGACCAAGACCCAGTGGAACCAGGTGCTCGACGTGCACCTCCAAGGAagtacgcgctgcagctctttcTCTGTCTTCTGTTATTGTA
TACATAGAGTGCTGAGCCTCTATGTATTGCCTGTGTGCAGCGTTCGCGGTGACCCACGCGGCGTGGCCCCACATGCGCAAGCAGAAGTACGGCCGCGTGA
TCCTCATCACGTCGGTGAACGGTCTGTACGGCCAGTTCGGCCAGACCAACTACAGCTCCGTGAAGGCTGCCATGACCGGCTTCGGCAAGTCGTTAGCCAA
GGAGGGCGCTCGCTCGAACATCAAGGTGAACATCGTGGCCCCCGGCGCCGGCTCCAAGATGACGGAGAGCATCATGCCCGCGGACCTCGTGGCGAAGTGG
AAGCccgagtacgtggcgccCACGATCGCCTTCCTGTGCCACGAGTCCGTGCCGTGCTCGGGCAAGATCTtcgagagcggcggcggcttcgtcgGGCAGG
TCAAGTACGTGCGTAGCGCCGGAGTGTTCCTGGACCTGGAGAGGGAGATCACGCCCGAGGCCGTGCAGGCCAAGTTCTCTCAGATCACGGATTTCAGCAA
CGCCACAGAcccggacgacgaggaggtgtCGCCCCAGCTCAAGCAGGTCCTGAACGCCAAGCTGTAAGGTGGTCGGTCACCGCTTACGTTGACATGAATC
AACCAGTTGAAGTCTCGACGCTCGGTAGTCGCCGTAACGAAATGAATGAACCATTCTTATGTTTCACACATCAAGGTTAACGTAACCCAGGTTACTTTTG
AGTAGCCTCGGGTTACCCGAAGTTTTTAAGACGTAGCGACTCATTCGGCAAAGACAAGAGTCGAAGAGAAGGAGGTCGAAGAGTAGTTAGGTCCACCCAG
CGAGGGAGTCATGATCCGTCTCAAAGCCAAGCaagccgagaagaaggccgaggagaaggaggcggaaGCGGCCGCTGCCGAGTCGGGCGAGGCCGCGCCG
GCCCCGAAGCCCAAGACGAAGATCCTGGGCGTCGGTCGCGGcaagcgcggcggcagcagcaaggagaagaagcgcacgccCGGCGAGATCCGCATCCAGA
AAGGTGGCGGCAAAGTGGGTGGAGAGAGAGCGAGAGGGGGTGGGGCTGACCTTtgctgtgctgtgctgtTGTCTGGGTTGAAGATAtcgcggagctggac
ggcggTAAGGCGGCCACAGTCTCGTTCCCGGAGGTGAACGACCTCACCGTGTTCAACGTCCAGGTGCGGAAGCTGGCAGTGGGAAGGGTTATATGCTATG
GGGGATtgtgtggtggtggagacTGACGAGGCGGTGACTGTAGATTGCGGTGGACACGGGGCTGTGGAAGGGCGCGACGTACGACTTCAGCTTTAAGATC
CCTCCTGTAGGTTGGCAGTGTAGAGAGTGCGAGGCTGTTGCGAGGAGACTGATGCGGCTGCGTGCTACGTATTTGTAGATGTATCCGCATGACCCGCCCA
AGGTCCATTGTCTGACGAAGGTGCGTTGGTCATTGAGGCAATTGGGTGTCAAGGACAATTGATTGATCTGTGCAAAGCATGGAGGATTCTAATGCGAAGC
GATGCTGATGAATTGCAGATTTACCACCCAAACATCGACCTTGACGGCAACGTGTGCCTGAACATCCTGCGCGAGGACTGGAAACCCGTGCTAGACATCA
ACTCAGTCATCTACGGTCTGATCTACCTGTTCTACGAGCCAAACCCGGACGACCCGCTGAATAAAGGTTCGTGGTATTGCATTTAGTAACTGCAGAAAGA
TCGAGGGTCTGAAAAGTGGATGCTTCGTTTTGTACGTTCCTCGCGagagcagaagctgccgagctCTTCCGTAGCGATCTGAAGCAGTTTGCCGCGGTCG
TGAATCGATCTTTGCGTGGATACAGCATCCAAGGCATCAAGTTTGAGCAGCTGATCTAAACTCACGCACCAAGCACAAGTAGTCGCAGGTTCGAAGTGGC
CAATTGATCGGTGGTTAATGAATACCACAGAGGTTTTAGGCCTATCATAGCGTCATAGACAGCACCATGGTCGCGGATGGATTAACAAAAACTCAATCGA
GCTGATGTTTTGGCTCAACTCATGCGGCTTTGTACATTTATTTTATTTTCACGCCGCCATCTATCGTCTTCCGGCCTGTTTATTTGTAAGGAAGGGAGGG
TGTAATGGTTCTGCTAATGCATACTCAGCATTTGCTGGATGTTGGGCTGCATCGGATTCGATCAAGTGAACGGCCTCGCCAAGATGGTGCTACGATATGT
AAAtggcctcgatctcttcgGACGTGGTGTCACGAAGGACATTTTCCTGTAAGAGGAGACATCAACGTCAAACCACTACGCTCAAACGAGCAAGAATGGA
TCATACAAGTCACGTACCCGTTCCAGCTTGCACTTGCCCCCGACAGCAAGGTTCAGCGAGTACTCGTAGAAGTAGCCGTCGGTGGTTGCCACATACAACC
GCACAATTGGGTTGTTAATGTCTCGTGGCCCATGAATTGCACACTGGTTCGGCACTCCAGTAGAGCGAAGTCGAGCCTGTCCGAAAAATAAAGCCATTCC
AGTTAGATATCGAAGAGGGTGCTGTATCGCAATTCATGATGTCCACGACGCAAAACTCACATAAGCAAAGTCGCGAGTGCCTTCAGCGATGCCAGAAAAG
GAGCTTGGCAAATATGCACTCATAACGCCAGCCACATCGTCAAAATTGCTGGCGGCTGAGCTAGAGCTGGTACGCGCCGTTCGCGCCGTGCTAGATATAC
CCGCAGCAGGGTGCATCAAGGGTTTACCAGGCGACGATCCTAGCGCAGTGGAGGCAATCGGACTCGGCGGTGCGGCGGCAGTTCCAAAAACGGTGGAGCC
GAAGGTACTTCCGGCAACTGCGAGTGTCGACGTGATCGGTGTAAAATGGCCGAAGCTTCCTGTAGCTGAGCTCTCAGCTCCAGtcagcgagaagaagtgA
ATGGTACCCGTGTCGCTAGATGCGCATAGGATTGTGGAGCTCTCGTTAAATGCCAAGCAGTAAACTTGGGCCCCATAGGATCCTCGTCGAAAGGCGGCAA
CCTTCTTTCCGCTTGGAACAGCAAATACACGAATCAATGTGCCCTGAATTGATTGAATATCATCACGAGGTCAACACCAAACCAGAGCAAACAGACGTAG
TTGCAAATGGTTCCCTTACCGATTCAGAAGCAGTTGCGAGCAGCGTGCCCTGTGGGTTGAACGCCATGGCCACAGGCGCTGTACGGTGAGCTTGAAACGC
GTTCAGCACACTGAGGTTGTTGGCATCGTACAGCACGATCTCTCCAGGTGAAGCGCCAGACGGGAAGGCCAAATGGCCATTGTCGTGTGGAGAGAGCACG
CCCAGTGCCTTCGGGTTCGGTGACGTGTCCAGTGTCTCCAGGATCTTCATGGTGCCGATGTCGAAAATGTAGATTTTGCGCTCCAAAACCGCCACCAGTC
TGCAAAGCCACAGCAAACCACAGACATCAGCCACCCGTAGTTCTCCATTCTCTAAGAATTGCCAGTCACCGCTACCTCTGTCGGTTCATGCGCACAGCCA
GCACGGCCGTGACGAAGTTCAGGTCACAAATGGCAGCCCCCGTCTTGGTGTTCCACACACGCAGTCGACGTGGAGAGAACGCAGGCTAAACGAGCATCCA
CGTAAGAGGCAGCAGTCGGCACGGGGTCAGCTAAGTGCACACGATGGAGGACTGGGAGGACAACGACCAGACCTGGTCCCCAGCGCCCACAAGAGCCACC
AAGCTGGTGCAGTACAGCATCTCGGCAATGCCGATGCCCCCAATATCTTCCTGGAAGCATTTCCCGAAGGGCTCGCAGTTGTAGATGGCGAAACCGCGGC
GCGTGCCCACGCTGATGCATCTGAGAACGATTCCCCCGGTACAGTCGTTAGTACAGACGTCATTCATTCACGCGTGTTACAGTGCCAACGTTGTGCAAAA
GACTCGCACAAGGGAATGCAAGCACGTACGAGGCCTCCTGGTTGAAATTCAGGAAGAGCAGGTCGGTGCGGCTGCTCTCAGCGCTCCTCATTCTTCTTGG
CTTGGCGCTTCGTCGTGAAATGCCTCGTCGGATAATCTACACTTGATTATTTTATTCTgcatttcagccaatcaaatGACCAAAGAAATATGCTTTTCAG
CCAATTACGGGATCTCAATAAATGGACAAGGACTTCAATTGCATGCAGCAAGACATGTTGcctcgccaagcagctcttTGCCTTGCCTCGGCGCAGGAAG
CCCAGGTCTACGAGGTCTACGTTATGGACTGCCTAATAGAGAGTACAGTATCACGCTTTCTAAAGCGTATGATAAAACGTCACCCAGAACAACAGTCCAA
TTCATCTCCACGGATTAGTGGCGCTGGATATATGAGCCGATTGCCAACGCTGATTAATGAAATCGGCCATCGAGCTCGCCTTAGTGTTTTTATGTTGGTG
CGCTTGCCCCCGCCATTAATACGCTTCCTCTCCTCGGATTTTGGGGACTGACATGCATACAGAGCTTTACGAGACACGAAGCTGTCCGTCCCGCAGTTTC
CGTCGACCGCAGCGTGATTCCTCACTTCTCAATTTTCCCCACCGGCAAGCCACCAGAACCTGCCAACATATGTCTAGTTGTCCCTCCAGACCGTCGAGAT
GAAGAGTCGGGTTGCTATTGTCGCTGCTTCTCTGGCAATTGCCACCAAAATAGACTCTCACGGATTCGCCAAGTACCTGAGCGAGCTCCCGAATGGCAGC
CTCTTCGAGCAGGCTCTGTCATTCCGGAAACGACagctcgaagacgacggaATGTGCCGACGCGGTCGGCAATCACTCCTGGACCGCCGAGCTCTGTGCG
GCCAAGTTCCCTGGTTTTATCATGACCAACGACGAGGCCTTCCGTAACGTATTTCACTACCGCACCTTACGAATGGATGGGGACAAGCCCCACCTTCTGC
TGCCACGAAGGGTTGTCCACCATCTTCTAACAGCGAGACGGACAACAACTGGGGAACGGCACCCACAccttcgacgcgctgcaaCGGATAGTCAGGTGGC
AAGACGCACCGCCAGTAACTTTCAGCTCCCCGACAACTTTGTCTGCAAGTGCGTGTGTTCAAGCCAAGCAACGATAAGAGTTGTCCGCCTTCGTTGTCAT
TGTCATGcttttaaaaaaaatacacGTCACCTTTTAGGTCTAAGAATATGCAAGACGCTACGCTCATTTCAAGCGAACTAAGCAATAGAGTTAAAGGGAC
TCAGCCCTTACCTTTCACGTCCATCTCCTGAGGAAGAAGTTCTGCTTCCCACGAATGATGAGAAAACCCAGAGCAGATAGAACTATACAAGTTGGTTGCG
GAAACCGCTGCCGTCAATAAGACAGATGAGTAGACTATGCGATTCTATGAAGTTGCCACAGATGATCAACGCGCTGTGCACACGCCCGCCTCACCATTTT
GCTGTCTGTAGATGACATGGTATTGTAGATGCATTACAGACGGATCCTTCCCATCCGCAGATACGGAAAACAGCACCTCCAGAACACGACTTCGATCCTC
GATTCACTTTTATCCGTAAAATACCCGACTGCACAATGCTCTGATATTCGAAATCGGACAAGGCAACACGCTTTACTCTTCCCCACGATCCTCACTTCTC
AAGTTGCCTCGCACCACCAAAACCAGCACCTCCAGATCCAACGCAAGACCACAAGAATGAAGATCCAATTTGtcgttgccgctgcagctctgaCTATCGC
TGCAACAATGGACTCGGCGTATGCCCTCGCCAAGTACCTGAACGAGCTCCCGAACGGCAGTTCCTTCCAGCAGGCACTCGGCCACCCTGGTGACGAcagt
tcgacgacgtcaGCCTTCGCTAAGGCGTTTGCCGCCGCTGGTCACACCTGGTCTAGTAGCCTGTGCGAGGCCAAGTTCCCTAGCTCGAGCATGACCAACG
GTGCCGCCTTCGGTGAcccgtgctgcacgtggaaGAAGGGCGGCAAGCCCGACTTCACGGTCACGgccttcaccaccacgccgGGCAAGGCCACGACGTG
CGCCTCGAAGGGTG