Description :
From Genome Similarity Track
Location :
Scaffold_2056:131- 6086
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh-piw_contig_2056-abinit-gene-0.10RNA-binding protein (AFU_orthologue; AFUA_1G02510)
Pytiw_DAOMBR242034maker-piw_contig_2056-fgenesh-gene-0.1Protein TAPT1 homolog

Sequence
5955 bases(100 bases per row)
CGCTAGCCAGCAGAAACAACATGGAGCAGCTGGCGTCCACGCACCGCCACACGGGGAAGCTCCCGCCGTCGTCTGGCGGCTCGGCGTCCTCCGGTTCGAG
TTCGTCGGGCTCGGTGCACAAGTCGTCGGGCTCGGCTCCGCACGACAGCGACGACCCGCAGCGACTGCTGCGCTCGGTGGATTCTGCGTCATCACTCAGC
TCAACCGTCTATGACGAGGACGAGCAGCAGCAGCAACTGCATCACCGTCCGGGCTCGGCGCCGCCGAATCTCAACTTTGAGTCGTCGACGTTTTTCAACT
TTGGGAGCTCGAGCAACTTCTTCTCGAACATGTACGTTGCCTGATGAGTGAAAGCGTTCTCGTGATGTACCTATAGCTACTGACTGTGTTACTGTGCTAT
TTTCCTGTTGTTATCTGAAGGAAATACGATGATGCAGACGAGTTTCCAGAGGGCATGACGTCGCCCACGGGCAACAACGACATTCTGCCTTCGCATGTGA
TCTCACCAACGAACCAGGCGAGTCACGACAAGCCCGTGACGATGAAGACGACGACCAGTGCGATCCCAGTTTCGCAGGGATTTCCTGTACCGCAGCATCG
CTACAGCAGCAACACCAGCGGCCACGCCGAGTCCAAGGTGACGACGAATGCTCGTCAGGGCCACGTGGCGGCGTTGCCAAGCCACCGGAAGAACAGCATC
GAGATGTTCCTCTCGCAATCACCGAGCCAGTCGCTTGGAGGTGATTTCCTGAAGCTCACTCTGGACGACCACAAGATGAGTCTGGAACGAGGACCTGGAA
ACAGCGGAGTTGTGGGTGGCAATGCGTTTGCGTCGGGCCACTTCACGCTCAACCCGGTGCCGGAGTCACCGAAGAAGTTTATCCGCAGCAACAGCAGCAG
CCACATCCGCAGCCACCAGCAGCAGCACGAGCTCCAGGCACCACCGATGATGTCGCGCTCGAGCAGCGCCAGCAGCTACAACAACTACCAGCTGAGCCCG
CGCATGGGATCGGAGGACTCGTGGCACGGAAGCCAAGATGGTGGACAGCAATCGTCTGCGGCGTACTACCAGGATGCGAGCCAGGACTACTATGGTGGCA
ACGGACAGGCTTCGCAGTACGACAACGTTCGCAGCCGAGAGCAACAGCAATCGCAGTACCACCAGCAGCAGCGTCAGCAGGACCATGGCATGTACCGCAA
CAACCAGAGCTCGTACAGCGGCAGCGGGTATGGAAGCAGCGGTCGTAACCAGATGTCGGGTGGAGGACAGTGGAACGCGAACATTGTTCCGTCCGGCGGC
GCAGCGTACAGTGCGAACGGCATGTACATGAACACGCCTCATGCGAATCCGATGCAGCAGCAGATGCTCTACCAGCAGCAAGGCGCATCCCTAGGAATAC
GTGGCAACTCTGGAGGTCGCGGGCGCCAGAACATGGGCAACAGCCACGGATACTCGCGCATGACTCCACCACTTCCGGAGGTGTCGCCGCCACACTCGCC
ACGCAGGAGCGTGCACATGGGGCTGGGCTCGTCCATGGGCATGTCGAAGCAGTGCAAGTTCTTTCTTCAGGGCCACTGCCGCATGGGCAGCAAGTGCAAG
TTCGCGCACCAACCAGTGCAGAACCAGCACCTGCAGATGCCGCAGCACGGCAACAGCAGCAACGGTCTAGGCGGTCGAAATGACGGCGGACTATACCAGC
AGCAGCCGCAACTGCAGATGTCTCCTGCACACGTCCACCAGGGTGGAGGAGACGAGTACTCGCACTCGTTTGCGCGCCAGCAGCAGTCTCGAAGCGCCTA
CCGACAGGCGGACCTCGGCAGCTTGAGCGGAATGAGCAGCAATGGCAGCAGCTTGAATGGCGGTCTTGGTGGCGGTTCTCAGACTGGCAGTAGTGCACTT
GGTGGCATCAGTGCACCAGGCCTGATCGCCGCTGCTGACGCATCTGGATTGAGCGCTGCTTTGAATGTGGAAGACATCCAGGGCCGCGTGTTCGCCATGT
CCAAGGACCAGAATGGCTGCCGTCTGCTTCAAGAGCAGCTGGACTACGAAGACCGCCAGGATCTGTGCGAGGTGATCTACCAGGAGTCGCTGGACCACTT
GGCGGAGATGATGGTCGATCCGTTCGGCAACTATCTTTTCCAGAAGCTGCTGGAGCGCGTGACCGAGAAGAAGCGACTTGCAATCATTCGCCGCGTCAGC
TCCAACTTGGTAGCAGCGGCGCTGAACCTCCATGGCACGCGATCAGTGCAGAAAGTGGTCGAAGTGTGCGCGACGTCGGCGGAAGTAATTGAAGACGACA
GCAGCTACGACGACGACGACCTGGATAGCGACGCTGGGCGACACCCGGGCATGCGTCGAACCGTGAACCTTCCAGACATTATCGTTGAGGCGCTGAAGGA
CGACGCGGTGCGCTTGTGCATTGACTCGAACGGCAACCACGTGATCCAGCGCGCGCTCCAGTTTATGAAGCCCGAGTACAACCAGTTTGTCTTTGACGCG
GTCTGCAAGGAGTGCACGACTGTTGGCACCCACCGTCACGGTTGCTGTGTGCTGCAGCGTTGCCTGGATGCTGCGAACAAGCAGCAGAAGGCGGAGGTGA
TTGCCCAAGTGGAGAAACAGGCGATGAAGCTGATGCAGGACCCGTACGGCAACTACGTGGTACAGTACGTTCTGGATTCATGCACTGCGGAAGAGGCCTA
CGGCGTGATCGTCAAGCCGCTGGGCAACATTTTCGAGCTCTCGATCCAGAAATTCAGCTCGAACGTGATTGAGAAGTGCTTGGAGAAGGCTCCCGAGCGC
GTGCGCCAGAACTACATCAAGGAGATTATCAACTGCCCCAAGATGAACAAGATGCTGCAGGACCAGTTTGCCAACTACGTCGTGCAGCGCGCGCTGTGCG
TGTGCTCGGAGGAACAGTGTCTTCAGCTCGTCAAGTCGATCCGTCCGCACTTGGCGGCCATGAAGAACACGTCAGGCGGCCGCCGCATCACGGCGCGCAT
TCTCAAGCGTTTCCCGAACATGGACATCAGCATGGACATGGGGCTCTCGCCCACGAGTGACGGCGGCATGTACGACAACAACGGAGGTCACTTGCAGCAT
CTGAGCCGACTGCCGCCTCAGGCGATGGGCTACGCGCACCAGCAGCAGTACGGCCACCAGCAGCAGCAGTTCAGCCACCACAGCACGGGATACGGCAATG
CGGGAGGCGGGTACCCTATGGCGCACCCTCACGCGAGTGGCCACCACGGCATGGCGTCGCACGGCAGGTATTCCAACCCCGCGCACCACCAACACCAGCA
CGGCTCGTCCCAGCACGGAGGCGGTGGTGGCCTCATGAACGACGTGGGCGTCGGCAGTGGCCTCGGCATGAACGCAGCCGGAACCAGCCGCGCGTGAGCA
TTGCCTCGATCAGACGGAAGCGAGATGGCGAGAGCGTGCGGCGACGTGGAAAAATGAATCGGTATAAGCCATCAAGTGGAGTTTGAAGAGTGTGTCGACG
GTGTGCGGATGGCTGGAAGGTGAAGAAGAAAGTTTTGCTCGTTTTGTAGATAAAAGAAAAAAAATGCATCAGGCTTGTGTATCAAAGAGAGGAGAGAGAA
GGAGAAAAAAAGAAGAGAGCGGCGTGTAAGTGAAGAGAGCGAGCGACGAGAAGGCGCAGCGAGCGAGCGAGAGAGTGCGGAGCAAGCGGACAGGCAATGT
ACAAGTAACCTGTATCAGTAAGTCCAAGCTTCACGCGTCGAACGCGGACGAGAAGACCAGCAGTTGAGTGTGAAACCCCAGAAACAAGACGAAGAAGTTG
CACGCAGTTTGCTTTTCGTGTCGCGTTGGTCGCTCGCGGCGTCTGTGGAAATTGGTTTTGCAGTCAAGGCTCGTAATATGAAAACACATTTTGAAGTCTT
GTGGCCATGCCAATTAATCTTCTCTCTATTTGCTCTCTCGTGTGCTGGTTAGAAGCGGTAGCGCTGGATGGACTCGAGGTGGCTCACGGCGCGCGGGCTC
TTGGGGCGCGTGTCGTCCAGCCGACCAGACTTGCACGCATAGATCATGAGCACGAGGCTGAGCAGCGCCTTGAAGGCGGCGAGGCACATGAAAAAAGCGA
CGGTCATGAGCGCCCCGCTCACGGACGTTAGTTGGAAGGGCGCGTCCGCGAGCGCCTTGCCCACCATGCGCAGCACGACGCAGGCCAGCGGCAGCGACAC
GAGCCCGAGCCGCCGCGAGACGTGGTGCGTGTGGTCGAGGATCGTGTCCTCGTTCTTCCAGCCCGTGAGGTCGCGACAGAGGATCGTGATGAACTTGGAG
TAGATGAACGGCGGGATCTGGTTGAACTTGGTGATGAACGCGTGCTTGAGCCAGTCGATGACCATCTCGGCGAGCATGACCATGGTCTGTTGCAGGTAGA
CACATTCACGCAGAGTTAGTTGTTGACATTTTTGAAGAGGTGGACATGTTAAGTAGGTGAACGCACCGTGCCCCAGGCGACATCCTTGGCGTTCGACTGC
AGCAGGATGAGCCCGATGATCAGCAGCAGCTTGAAGCGCTCAACAATGTCGCTGCACGCGATCTGAAACAGGTTCTGCTCCTCAAACTTTTTGAACACGC
AGCTCTGCATTGAAATCCCACCCACCACCATTGTCAGACAGTCAATATGAAGTCCAGGTTACAAATTTTAACATGTTTACCTTGAGTTCTGCAAAGTTGT
TCGAGATGAGCAGCGTGAGCAGCGACGTGTTGCTCGAGTTGATCGCCACGTTGATCGTCACGACCTGCGCGAAGAGCAGCAGCGAGTGCAGCAGTGCAAC
GCAGTCAAGGAGAACCACATTTCACAAACCATGCAAGTTTCATCATACAACATGCAACAGTAGATCAAGAGGATATCGACATAGATGGTCGCGACGGCAA
AGTCGAGGAACATGCGACCGACGCGACGCGGCTGGTACTTGGCCGTGTAGTAGAGCGAGTCGAGGATGTCCTGGCCGAGCGACGAGAAGAGCCGATCAAA
GATCTACTCACAACAAGAGCAACAACAGAGTTAAACACAACTACTCGCATCAAAAACCACCAGAGTATGAGCCAAATGAACCAACCTCGATCATGGTGAA
AAGCACGTAGAGTTTGATCATGGCCTGGCCGCGGATTGCGTGGTAGACGCGCGACATGTCGACGCGCCAGAGCACAAAGGTGGCGACGGCGATGATAACG
GCGACCATGAGGTCGTAGAAGTGCGTGCGGCGGAAGACGCGCGTGTGGAAGGACGACGTGACGGCGCAGCCGCAGGCGAAGAGGATGCGCAGCGGCAGGT
ACGTGAACACGTAAAGGAAGCTGTCGAGCGCCAGAAAGACCCCGAAGAGGAACATCTGCTCGATGTTGTAGGGCACGCCGAAGAAGTTTTGCACGCGCTC
CTGGTGCATCTCGTCCGTCTGCTTGATGTCGTGTACGCCGAAGATCTCCTTGTAGAAGAAGTCGGAGAGGCGAAACGCGTGCGGCTGCGGCTGACCGCCT
GTGCCCACGCTGGTGGCGGAAGGCTTCTGGTCGCGCTGCAGCAGGAGCAGGGCCGAGTCGTCGCTCGCGTCCACCGTGTTGCTGGTTCGCGAGCCATTCG
AGAGCAGTGGGGACTTGGGGCGCGGACGCGGCGAGGCTGAGGATGTGGATGTGGACGGCACCGAGAAGTTGGTCTGCACGCGCAGGTTGTGTAGCCGCTG
CATGCGCTGCATGGCCAGTGGCGACAGCGCAGTGGGCCGAGAGCCATTCGCACTGACAGCGGTGGTCGGACTGCCACTGGCGCTGTTGCTGCTGTTGGAG
ACCGTCTTCTCGCCCTTATTGCTGGTGGGCGACGCTTGCCCACTGCTGTTGGTAACGTGCTGTGCGTCTTCAGTGTCATCGTCGTCGTCATCGGCGGGGA
GGAGGAAGCGGTTGGGCAGCATCGCGAGCTTGGCGCCGGAAGGCGTTGGGTTGCT