Description :
From Genome Similarity Track
Location :
Scaffold_608:131- 1510
Sequence
1379 bases(100 bases per row)
ACAATGTTCCGGTCGACGCCTCACTTCGACTAGGGCTGGAAGCGACTTATTACGTGTCTGTTCTATTTCCTGGGTAATGAGGGAAACCTCATTACCAGAA
GCTTGTACACAATGATTGAGTGTTGGGAGCAAGTTTCTGCTCCATGGCTGCTGACTCGCTCGACGTTGCTGGATCAGTAGGGTGCTCCGCACCTACTGAC
CCTGACCGTTTTTTTGGCTGTCCGTTTCGTTGATGCGTCTTCACATCAACGTCGGACCCACGCCTTGGGGCCCGCTTGGCCGCTTGGCGGTTATTGTTTT
CTGTGGTACGTGGTACCGCGCTCGGGGCACTGCTTTCACATGCATAGTGCCCTGTCTTCTGACATATATTGCATTTTGCAATTTCTTGTAATTGTTAACA
CGAGAGCTCTCGTTCCTCGCGTTACAGAGTTTCATTGGTTCTGGGCCTCCATTTTCCTGTCGTCTTGACGGACGATAAGAATTCGAATTCGTGTGAGCCT
GTTTCACGCTGAAGTCCTCCTGTTCCGCAACCCTTATCGCCTCTTCCAGGGTGTTGAATTCCATCCGGAACAGGTAGGTTTTGACAGGACCATCAGTCAG
ACCCTGCATGAACAACGTAATCAACGTTTGTTGATTCAGTGGGTCGACTGTTATGCAACTGGTAAGGTGACGTATGTACTGAACGTACGAGTGTACGTCA
CGTTTACCTTGCTTGATTCTCAGAGCGATCCCTAAACTCCGCTCGAGGCGGCTCAAATGTTTGCCTAAGCAGGGAATTGAAGACTTCATACGACCCAAAG
ACATATGGGTCGTGTAACTTCAGGCCCAAGGCCCACGTCTTTGCACGCCCTGCAAAGTTCGATTGAGCAAATGCGATCTGCATTTGCTCATCGTCGATGT
GGCGAGTCTTTATGGCATCGTCTAGTTTCACGAACCATCTCAACAGAGAGTCTTCGTCGGCTCCCTTGTACTTTGAGATGTCAATCTTTAGAGTCTCGGG
ACGATGTGTATACGTCGACCCGGTAGCAGTGGCCTGCTGCTGTCTCAACAGTTTCAAACTGTTGAGCACTATGTTCTCTTAACAGCTCTGTCTGTTGAGA
ACCTTGTTGGTGAAGCAAGGTTACCTTTTCCCGCTCGACGTCAAGTTCATTCTGAATGAACTTGGCGATGGTGGCGAGCTGGCCATCCGGCCCCAGGGCG
AACAGCAGTGCGCCAACGGCTTCTTACCCTATCGTCGAACTCAAGCGTTCGATGGCATCCCATTCGATTTGACTCAAATGGGAGTAGCTTTCATGCGTGG
GATGAAAATCATCCCCCTCAATCGTCCAACATGTTCATGGTCGTTGAACGGACTACGAAGTGATACCAGGTGTAACGGG