Description :
From Genome Similarity Track
Location :
scaffold_1790:131- 1508
Transcript NameFunction/comments
g11692.t1 polyprotein

Sequence
1377 bases(100 bases per row)
ACCACTGCGTCTACATCAAGAGGAATGATCAAGAGATGATCTTCGTGGTGCTATACGTGGACGACCTGATTCTGGCAAGCAGAAAAGGCTTTGGTCGGTT
GATGGCAAAATGCAAAGTGATTGATTTAGGTCCTTAGTTCGCAAACTCCTTGCTACCTCTAAGCCTACTGAATATTCTACTGGATACACTCTACTGGATT
CTTTACTGGATACTGAGTTACTTCAGCCAATCAGCGACTGCCACGTGGATGCCCATCTTGTATCCACAATCTTGTCCCCACGTATCCCATAACCCCCGTA
GCGTAAACAGCGTCCCATCATCAGTGTCCCATCATCAGTGTACCGTAAACACAGGAATGATTGCGGTCCCACTGACTGAAGGTCATACCGGTATCTTACC
GGTATGCCGCAGCTGGTCGAGGCGTCTTCTTGACAACACTCCCACTCGACTTGACAGCTGTTGCGCCTTGGATCCCCAACTTGCTCCGAAGAACTTCGAA
CTGCACAGCAGTGATCGCCTTCGTCATGATGTCGGCCAGCATGTCTGTAGTCGAAACATACTGTAGCACCACTTGACCGTCTTCCACCTTCTCGCGCACG
AAGTGGTAGCGAATGTCGATGTGCTTGGTGCGCTTGTGGAATTCGGGATTCTTGGCCAACGCGATGGAGCCTTGGTTGTCCTCGTAGATCTTGATCGCTT
CATCGTTTGCCATCTCGCCGAGTTCGCACAGGAACACCTTGAGCCACACCGCCTCTTGCGTTGCCTCTGACAGCGCCATGTACTCCGCTTCCGTAGACGA
TAGTGCCACCGTCCGCTGCTTCTTGCTTCTCCAGCTGATGCATCCGCCGTTCATCATGAACGCGTAGCCGCTTGTACTACGTCGAGACTCGATGTCACCA
GCCCAGTCCGCGTCCGAGTAACCACACACGCCGAAACCGTCTTCGCGTGAGAACTCGAGTCCGTGCGTTGGTGTCGCCTGCAGATACCGCAGCACACGCT
TGAGAGCTTGCCAGTGCGTCGGACACGGATCAGCCGCAAACTGGCTCAGCACTCCCACTGCAGCAGCAAGGTCCGGACGCGTCGCCACCATCAAGTACAT
GAGAGCACCGACGGCACTCCGATACGGCACGTTCTTCATGGTGTCTTCATGCTGGCAGCCACCCTCGCACATGTTCTTGGTCAGCTTGAGTCCGGGGTCC
TGCGGCGTCTTCACAGGCTTGCTGTCTTGCATGCCGAACTTGGTCAGGATGGACTTGAGAAACTTGGTCTGCCGCACCGTCACTTTTCCGGAGTCGCGAT
CGTTCTTGATCTCCATCCCGAGAAAATACTCGAGCTCGCCGAGGTCCGTCATCTCGAAGCGTTCACTCAGCGCGCGC