Description :
From Genome Similarity Track
Location :
Scaffold_3705:131- 1374
Transcript NameFunction/comments
Phyta_totarag15430hypothetical protein PHYSODRAFT_262200

Sequence
1243 bases(100 bases per row)
CAAGTGCGTGACGCATATGTTGAACGTCGCAGAGGCGTTCTTTAACCCCTGTGGCATGATGAACCGCTCCCAAAGCATACCGTTTAGTGTCCTTACTGCC
GTGAGAGGGGTATCGCTCTCACGTATCAAGATCTGATAGAACCCGTCTCTCAGATCCAGAGCACTATAGATTGTGCTCAGGGCCATCGAATCGATGATCA
CATCTTTTCGCGGTATCGGCGTCTGTGCCGGTATCGTCGCatcgttcagcttgttgtaCGCATGAACGATGCGACAACCGCCCTGTGGTTTCTTAACACA
GAACGTCGGTGCACTGTGCGGGGACTTTGATTCCCGCACTTGACCTGCCTTGCGACGactctcgaagaagtcgtcgatcgCCTTCACTAGCTCTCGCGGC
AGTGACCAATGCCCCATGCCACAGTCGGCACGAGGTCAATCTCGTGCTGAATTCCCTTGTCCGGGAGTACGTCCCTGTACTCTCGCAGAATGTCGTAATA
GGgactcgacttgagcgagtccTAACTCTGCTcttcgctgcgctgcttcttcgtctaGGCGCTGAGAGTGTCCTCACTCTCAGTGGTACTCCCAGCGAAG
TGCTGCTTCAACTCGTCCGCctcgcacttcaaccttTCTCTGTCTGAAAGGATGCAAATCTGCTCGGTGCGTCCATCGTGCAAGACGCGCGCGAggcgct
tccagctcatgaCTGAAAGCGACGTCAACTCCGACGCACTCGTCGGAGGGTTCTCAAGGGTCATAGTCCTGTACTGTAACCCAGTACCGGTCTGCGTCAA
GACATTCAATGTCTCGACGCTCGACGTCGGAACTGATGTCTGCCCGGCAGACATCTCTCTTAGCGTCTCGGTCCCGGACCGAgactcgcgcagcttcttc
tgcttgcgcCGTCTTTTCTTCCTTTTGAGGAGACCAGCCCCGCGAATTCCTCGTCCATGCCCAGCCGTGGACAGGTTCGTGTTGTTATCGCCAGCGGATT
CTATCCGCGGGTGCGCGTCATCAAGCTCGGCTTGACGCACgttcgcttcttcgtgcagccctGTTGCACGTGAGCTTGCAAGCTTTTCTTGTGCTGGACG
TTTGCAACCGTCTGTACTGCTCGCCGCGGCAACTCCCTTAGCTAACGCGCCTTCGTTGCCACGACGCTTTTCGGCGGAGTTACTTGCCGAATCTGGCCCA
ATCAGATTCGCGTCAGCTCCTAGAGCTAACTCTTTGCCGTCAC