Description :
From Genome Similarity Track
Location :
Scaffold_3605:131- 1337
Transcript NameFunction/comments
Phyta_totarag15379hypothetical protein PHYSODRAFT_525100

Sequence
1206 bases(100 bases per row)
GATGCCGTGcacggcaacgacagcgTCGCCCGTCTTCAGCCAGCCAAGATCCTTGCCGGTTTCCGTGGCGCGGTACAGGATCGAGTCCGTGCCGATCATC
GAACCCACGCAGCGAGATACAACGCCCTTCACGAAGCCCTCCGTCTGGCGAGCAGTCTGCTCCAGAGCCGTCAGTACCAGCACAGGCATCTGCGGACGGT
ACTTCGCCACTAGACGAGCCGTGTTGCCCGtctccgtcagcaccaccagcatcttcgcgTTGATGTCGATGGCCGTCTTCACAGCCGACGACGCAACGGC
CTCAGCCGTCTGCATCGGGCCGttcacctccagcacggcgttgCGCAGCGACTGGTACACGTCGTTGTAGTGGATGGCAGTCTCGGCCTGCAGGCACGTC
GCAGCCATCACCTCCACAGCCTGCACCGGGTAGTCACCGTTGGCAGTCTCACCCGAAAGCATCACGGCGTCCGTGCCGTCGAGCACAGCGTTGGCCACAT
CCGTGCACTCGGCACGGGTCGGGCGCGGTGCATGGATCATCGACTCCAGCATCTGCGTGGCCGTCACCACGGGCTTGCCGGCCAGGTTGGCCTTGCGgat
catcatcttctgcgCAAGGAACACCGTCTCAGGCGGGATCTCCATGCCCAGGTCACCACGGGCCACCATGATGCCGTCCGTCTTGGCCAGGATCTCGTCG
AAGTTCTCCAAGCCCTCGTGCGACTCGATCTTTGAGATGATCTTGATGCCGCGGCCACGGGGGCCAAGCACCTTGCGGATGTTGACAAGGTCGTGGCCCG
TGCGCACGAACGAAGCGGCGATGTAGTCGATGCCGTGCACCAGACCGAAGTTCAccaggtcgtcctcgtccttctccgtcagcGTCGGCAGTAGCACCTT
GCACCCGGGCAGGTTCATGTTCTTGCGCTCGCCCAGAGTCGCCGTGTTGTTGGCACGGGCGACAATACCGTTGTCCTTGATCTCCGTGaccgtcagcacc
agcgagcCAtcggccaccagcaccgagcCACCAACCTTCACGGACTCGGGCAGCTGCGGGTACGAGCACGCAATCTTGGTCTCGTCACCGAGGAACTCGT
AGTCCGTCGTCAGCTCAATGAGCGAGTCCTTCTGGATCGTCACCTTGTCGTGGTTCTTGAGGAAACCCGTGCGGATCTCGGGGCCCTTCGTGTCCAGCAT
GATGGC