Description :
From Genome Similarity Track
Location :
Scaffold_4:1309923- 1311802
Sequence
1879 bases(100 bases per row)
TGTCGGAGGCAGTTTGCCGCGACGCCGCAGCCGCAAACGTTGGTCAATGCGCCCACTGCATCATCGGGTGGCTCCGCGGCAAGTTCTGCAGCGAAGAGCA
GAAGTTTGCGTCCGCCGTGGACGTCTACACCAAGTTCCACGGATTCAAGTTCGAGCGATGTTGCTCGCTTGACGGTAGCCTGGCCATTTTCGACAAGCTT
CGAAAGGCCGTCGAAAAACGCGAGAGCACGACTCTCAGCGACAGCCACCTCGCATCGGTGTTGTTGTCCGCGCTGCCTGATTGCATTGCACACGATGTGC
AAGTATGGCGCGGTGCTCGACCGAGCATCCCATACACCCAGCTGCGGGAACTCTTGCCGCAGCACTGGCACGAGTTGACCCAAACCGACGGCTCATGCCG
TTCCGGTTCATGGTTCGGGCCAAGCGCCCGAAACCACTCGATCGAGCGCGTTACGCCTCTCGAGCTATGATGGCTACGGTCAAACGACCGGCCTTAGTCC
ATGGCGCTCCCAGCGCGACATGCCATCGCGGCTATTGTGGCTACTGCGCACATGCAGGTCACCGCACGATAGATTGCACGAAGCTTTCTCATGCATTCCA
CCAAAACGCGGTGCGACGCGATTTTGTCTTCCCACCCGGATGGGTGGCGATCCCACCAGGGCAACTCCCACCGCACGGCGGTGGTCGACGAAACCAACAC
GGCCAGGGGAGTGGGCATTCCCACCCCGACAAAAGACCCACCAATCGCCCACGCCGCGGTCGTGGAGGCGGTCGATCCGCCCATCACCAAGTTGATGTTG
GTGCGTTACTCAATGCACTCCAACAAGGCCTAGCCCATGGCGGTCAAAACCGAGGTGGCTACGCCCACGGCGGCCGCTCCCAAGGTGGTTACGATCACGG
CGGTTATTCCAACCGCGGCTACGCCCAAGGCAGCCAACAAAGAGTCGCGTCTTCGGACCGACGCGATCAACGTGACCAAAGTCCGTTTCGCCACCACCGC
GATCGCAACCACTCGCGCGATCGGCCCGATGATTTCTTCAATGATGATTATCATTGTTTGGCTCCTCCAAAGCTGTACCCCGTCCAAGATGACCCGCGAA
GCCGCAGTCGCGGCACCCACCAAGGTGGCCCCGGTGAAAATACCGGAGGAAACGAACTTCGTAGTCGTAGTCGTAGCGTAAATCGCAGCGACGCTTCTCG
TCAACATGAGACTCGTTATTACACCAGACTCGTTATTTCAGTCTTCATGAACAGGCACCTTTGCCAAAAATTACGACATCTCGTGACAACAAATCGGCAT
CAATGCCTCGATTATCTAAACCTAGATTAAATAAACTTCAATCGGCATCATTGCCTAGATTAAATGAAATTCAATCGCCATCATTGCCTAGATTAACGAC
ATCTCTTGAACAACACAAACATGTCTCGTTTTCGGTACCACGACAGTCCACCAACACTTCAAGTATAATTCCAAAATACTTTCGAAAATACAAAAAGACT
TTCGTCCACATTTTGACTCGCTCGATACATTTATATCGCGGTCTCTATTATATACAGCTACTGGCTGGGCACCTCGTGTGTCACCGACTAGTCCTATAGT
TCAACAACAACTAGACTCCTGTCTATGGACAGTCGACAGTGGTGCTTCTAAGCACTCCACCTTCAAACGAGAATGGTTCGTCACATACGAAACCTACTCA
TCACTAGCTGGTGCAGCCGATGGCCACCCACTACACGTCGTAGGTCGCGGCACAGTTAGACTTTACGTCACTGGCTCCAACGGCGACCCATTGGCGATCT
ATCTGCAGGATGTATACCACATCCCAGAACATCACTTCGACCTCTTTTCCGTTGGTCGAGCCCTACATATGGATCGACA