Description :
From Genome Similarity Track
Location :
Scaffold_3:13097- 14438
Sequence
1341 bases(100 bases per row)
ATGTGAACGACAGCTTCATTGTACGTCGGAGTAGCAACAACTGCAGGTTTATGCCTTACGGAAGCTAAGATGCCCGTGAATCAACCTTTATATGCCTAGA
TCTCTCTTAGATTTCAAATTTGTGTGTGTGTGTTTGTTTATTTTTCGAGTGGTTTTTTAAAGTAGCCTTGGCGGCACGGACCATCTCCTGGGTGTGGCCG
CCTTGGTTGAGCAGCCGCTAACCTGTTTGCGGGTGCTAGCAGATAAAGTCCAAGCGCAAAACCAAGTGTGAGGACAGCAAGGGCTCGAAGTCATTCTCGC
GCATGCCCAAGTCCATTTAGCGGTTTGAGAACAACAGCGGCTCGAAGATCTTCGCATCCATGACTGGGCAGATGGACCCACCCGAGTAGTTTAAGCACAG
ACAACGAGACCGTGTCAGAGCAGGACCAGCGATATAGGCCCTTCGGAGCTGTTGTCACTTATAGCTGAGTCGCTCGATACCTAGAAGGTAGGAGGCAACG
AACGGCTAGGAGCGATTGCGCATGTATCCGGCTTGACCAAACTGTTTTGAGGGATGTAATGGCACAGTTATGGCTGCAGATTGCGTCTAAATGCTGCACC
TGTGGCAGCGCAAGAATGGGTGCGGACATGACACGTCCCAAGCGCGCGATCAGCGATGCATGAGCACTCTCAACGGGGCCACGACCCGTTGTTTTTGCTA
GCTTGTAATGGGTTAACGTCGGTAGCGGCGGCTCAAAGAAGTTGCCTATGCCTCGTGGCCAACCTAACAACTACGACATTTTAGGACAAAGGAGGAGGCG
CCAGCTCGGTAGGACTGGTCGATGTATTTAGAAATCATCCATGGCAGCTGTGGTTGAGTCTAAGAGCAACCAACAGTGGTGCGTCAAACATGGTGGCGGT
TGCTCAGCCATCTTGGTCCCATTTGTGGAGTAAGAGGTTCTCCCTCAGTCTTAAATCTGCCCCTTCAATAGGAAGTACCAGCGTAGCCAGCATGACTCAA
GCCGTGTATAACGGAGCGCGCTCATTAAAAGTTACAATTTCAAAATTAGAGCTACTTAAGGGTGCTCTGTCTACCGACTTCGGCTTCAGGTGCAAGATCT
CGCCATGATACCTATGTGCAAGTTTTCTGGTGTGAAGTCTACACGTTCGTGCGATCAGATGATCCGATGGAGGACGTCAAGCCCATTGAGAGCTGTGATT
TCATTTCGACCATGGCTGCTTCTCCATTTTCTACTAGGTTTTCTGAATTGGCTACTATTTTCCCCACACAGCCATCGATTCTGCTGCTTGATGATGGGTA
TATTCCCCAAGACAGCAGAATTTTAGTCGCTATCCTCGATA