Description :
From Genome Similarity Track
Location :
Scaffold_20:130964- 134793
Transcript NameFunction/comments
Phyke_g1283hypothetical protein PHYSODRAFT_350602
Phyke_g1284conserved hypothetical protein

Sequence
3829 bases(100 bases per row)
ATCACGATGAAGCAGGAATCGACCTCGCTGCCTCGCTTGCTAGTGCTTTACGGCAGTGAGACTGGCACGGCACAGGATGTGGCGGAGTTCATGCAACAAC
GTGCCTTCAATCGCCAGCTACTGGACACACAGGTCTCCGCCATGGACGACTTCCCCGTGGCGCAGTTACTGCCCCAGTGCTCCACCGTGGTCTTCGTAGT
ATCCACCACAGGCGACGGCGAAGCGCCAGAGAATATGCGTCGCTCCTGGCGCAATCTGCTGCGTAAAACTCTCGAGAGCGAGTGGCTGGCAGGTGTCCGC
ATTGCTGTCTTCGGACTGGGCGACTCCAGTTACGCCAAGTACAACGCGGTGGCTCGGCGTCTACAAGCTCGTCTGCTGCAGTTAGGGGCCTCTGAACTCA
TCGACCGTGGGCTAGGAGATGACCAACATGCCTACGGATACTTTGGAGCGCTGAACCCGTGGTTGGAGAAGCTCTGGATGGCTgtactgcagctgcaccc
TCTGCCAGAGGGGTTTTCCATCGACGACTCGCCAAAGCCGCTCGAGCCACGCTACTCCGTCGTGATGCATGCTAAAGATACTGCTGAGGCGGAGGCTGCA
AGAGCGTTGACTCCGAACTCGGACTCGTCGAAATTCTATGCGCCTCCGCTTACGGTGGTTGGACGTGAGAAGGGCATTATCCTAGCGCCTGTGACGATAA
ACAAACGTATTACAGCTTCCGACTGGGAACAGGATGTGAGGCACTTGGAGTTTGATATCAGTGCTTATTCGAGTGCAAGTGATACTGGGGGCGCTCCGTT
CAGGGCTGGTGATATCGCTGTAGTGTACCCTGAAAATGTGACTGGTGTAGACGAGATGCTCAAGTACGTTAAGCTGGATGGCGAGTGCGTCATCTCGATC
AACGCTGCAGATGGCTCGAAGCAAGATGACCTTCCTTCTCCCATAACAGTTCATGATTTGTTCTCCAAGTATTTGACCATCTTGGAAACCCCGCGTCGAA
GCTTTTTTGAGAAGCTCTCTCTGTTTGCTTCAAATGACGAAGAGGTAAGAATCATTGCCCACTGGTCGGCGTGCAGTTATTGCGCTCACTCTGTTTATGT
GACAATGTTTCAATGCGGGCCGTGTAGAAAGAGAAGCTAGAGGAGTTGGCATCAGCTGAGGGCGTGGATCTGCTCTACGACTATTGTATTCGTGAGAAAA
AGACGTATGTCGAAGTGCTGTCGGACTTTACAAGTGCGCAGGTGCCTTTAGCGAACCTGCTACAGCTTATTCCTCGCCAGCAACCCCGCTCGTACTCTAT
CTCATCGTCGGCTCTCCTCCACCCTGGTCGTGTAAGTATATTATCCATGTTTTAATTTTTGTAGCGCGCTACCACGTCGCCACTTATCTAATTCTATCCG
TGTGTGGCGATAGATTCACTTGACCGTGGCAATTGTAGATTTCTTGACACCTTACAAGCGCCGTCGAGGGGGTATTTGTACCTCCTTCTTCCAATCGTTA
GATCCATCAAAAGAGACGAAGCTCGTATCGATGTGGATTAAGAAGGGACTTTTCGACCCACCCACTCTCGAGCGCGACATGCTACTTATTGGTCCCGGAA
CCGGACTCGCCAGCATGCGAGCAATGGTGCAGGAACGGCAATATCTACACGCACACACAGGTGACAGCGCCCACCACGGAGAGACCTACTTCTACTTTGG
ATGCCGTCACGAAGACAAGGTACGGTTGAATTATGTCGGAATGCGAGCCGAGTATCCACTGTAATTTGAACTGAGCTAACAGTGTTTGCTCGCTCCATCC
AGGACTTCCTATATGGTGATGAACTGCGTAGACTCGTGTCTTCGGGCAATCTCACGAAGCTGCATACCGCGTTTTCGCGTGACCAGGTACGCGACAGTAA
TGCCATAAACTCCTGCGCTTTCCACTTGCCCAAAACTGACCAGAGTCTCGATTACCATGACGACAATCTTGCAGAACCATAAAATTTACGTGCAGACGCG
TCTGGCTGAGAACAAGGAGGCTGTGTTCGACTTCATGATGAACGGAGAGGGGTGCATCTATATCTCTGGCTCCGCCAAGCGAATGCCTACTGACGTGTAT
GAGGTGCTTCGTGATATCCTGCGTTCAGTAGGTAAGATGCCGTTCGCGACAGCagagaaggtgatgaagacattgGCTCGTAAGAAGCGCTACGTGGTTG
AATCCTGGTCGTAGGATTCTCAAATATCATCTCGACACTGTCCTACGACGAGGTGTTGTTAAACCAAAAGACTCTACCGTAGACCAGTTTTGCTACATTG
TCCTTATTAGGTCGTTGAATGTCCACCTGCATGTCCACCTACAAAAAGCTATATATTTGGGTATATTTGATTCTGGGCCCCTATTTTGTACCTATTTTTG
CAAtgacgctggagctcaagaaggaggaacATGTCCGCACATTCGTGAAGCTCGCGAACCTCACACAGACCAAGCAGCTTCACGAATGGAACCTCGAGTC
TCTTCAGAGAGCTCTGCAATGGGCACGAGCAGCTGAAAATGTAGTGAATAGCGGGGACCCCCAGATGGACGTCGAGAGGCGCATCCGTCAATGGTTCCCA
GTCGCCACTCTGCCGACTCTGCCTCTAGACGAGGCCTTGACTGCCAATGCACTACAGCACGCACACATCCATTTGTTGCGGTCTATTTTACAAAGTCCCT
TTTTGGCGACGCACCCGACGCGGTCTCAATTGGTGGTTGCAGTGCTTCAGGAACTCAACAAATCCCACGAAGAGTCCTCGTCGACTGGCGATGAACTGGA
GACGCGTTCCTCCATCAGGTAATGGGATGCTGACGCATTTATTCAAGTTGGAAGTGTTATTGCACGACTTTTACCTTGTATTTTGGTATTGTGGATGCTT
AGTGCACTGCTGACCGATCAAGTAGTCAGAGCTCCACGAACAGAGGCCATGCTGGCAATTGCTCGTCGGGTGAGCGAAGGCTCTAAACCCATTCGTGTAC
AAGGTGACTACTATTTTACATGTATCGGGGCGTAGGTTTGATCGGCTAAGATGTCTGAATTTGTGGGTGTGAAGTGCTGTCTGGTTGGGTCGAGGTACTG
CCTATCAAGTGTTACACGCTCTCGCCACGTACACTCCAATTGAAGGTCATGGCAAAGACACTCCAGCGGAACGTGGTGGATGCCCGCGCAGCGGTCGACC
CTAAAACATATTGTGTCTTCTTGAATGATTTAAAAACCTGCTTTGTCGATCCTGCCAACAAAGATGTCAGGGTAAGTTGCGGTGAGGGGGTTGTGTAGTT
TGCGTCAGTTCTGTTGTGCCACTGATGCTCGCGTTTTACTAAAAAACAATATGTATTCGTTGCTAGGAAACTGTGGTACTAATGCTCGTCATGTGCGAGT
GGCCAGTTGAGGAACCTGAGCAACTCCAGGGGATGATGGGGGACCTCGTGAAGATTGTGCAGGACTGGGTCACGTGCAAGCCCATTCGATTCTGGGCATT
CCAGCCATGGTTGGCAGCCTTGCTGGCTAAGAAATTCAGCGTACTCAGAGATACTTACGTTTCTGAAATGTTCGATGCAGGACTCTTATCACCATGTACG
ATTGCTACGTTTGAAGTCTCTTTGTGGCTCACGTTGCAAAAGGCAATGCCCATATTCACACCACATTCGATTTGTGCCTTGAATGGCATGTTGTGTTGTG
CAGGGGAAAGAGATTTTGCTGAGCGTGTCGCAGCGCTTGTCTTTCAGAACGAAGATATGGACGCCAGACTCGAGCAGGCAATAGCGAAGCTGGATCCACA
ACTACAACACCAGTACTTCAATGTAAACC