Description :
From Genome Similarity Track
Location :
Scaffold_620:13094- 14338
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_620-fgenesh-gene-0.5Isoform 5 of Mucin-1

Sequence
1244 bases(100 bases per row)
CTGGAACGCTCGTTTCTGGCTTCTTCACCTCCGATGCTCCGAAGCTGAACGCTGCCTTCTTGGTGGCTGGCTCGGAGCTTTCATTAACAGCCGTGGAAGG
AGCAGCTCTCTTTGGAGCATCAACTCCGAACGAGAAGCCCATTGCGCTGCTGCTACTGGAGGTAGTCTTGACTGGTGAGCTGGTGCCAAACGAGAACGAA
GGGGCTGCCGTCCCTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNTGTCTCCGTCTTCTTCTCTGGTGCTGCAGATACACCGAAGCTGAAACCAGTCGACGCAGGGCTCTTTTCTTCGCTACTGGGGGCAGCC
GGCGCGCTGAACGCGAACGACGGCTTCGAAACGCTAGCACTCGAAGTCTCTGGAACAACACCGAACGAAAACGACGGCTTTGTCACCTCCGACACAGTCG
AGACTGGGGGAGCGCTGAACATGAACGACGGGACCGAAGCGTCACCATCACTCGCTGGCTTCGGCTCCACTGGGGTGGTGACTCCAAACGAGAAGCCAGT
TCCACTCTTTGGTGCTTCAATAGAGGCTGGCTTGGCCGCCGCCGCAGCCGGTACGCCGAACGAGAATCCGCTCGAGGTGATCGTTCCTGCCGTCTTCGCT
ACAGGTTTCACTGAGCTGACAGCACTGCCGCCAGGCTTCGCAGTCTCACAGCACGGGCACTTTGCATGCTTCTCTTCATTTGTCACCGAGCACGTCGAGC
ATTTCCATTGGCCAGGGGCCAACTGAGCAAATCTGGCCAACGGATTGAAGCCACTCGACGCGGCTGATGCAGGAGCAGTAGTAGCGCTAGTCGACGGCGC
AGGAGCACTACCCACAGGTTTCGCCGTCTCACAGCACGGGCACTTCACGTACTTCGCTTCGTTTGCCACCGAGCACGTTGGACACTTCCACTGGCCAGGC
GCCAGTTGAGCAAATCTGGCCAGCGGGTTCACTGAGCCGGTTGATGCTGTTGGCGCACTTGTTGCAGACTTCGCGGTGATTTCTTGTGGCTTCTTCGGGG
CCGTTGATTTCGGTCCGAGCCACTCAGCGCGTGCCTTCGGGGAC