Description :
From Genome Similarity Track
Location :
contig_60:130922- 132155
Transcript NameFunction/comments
g11161.t1hypothetical protein

Sequence
1233 bases(100 bases per row)
CTGGAGCTAGAAGACAATGACCAACCGCGCAGGCAAAGTGGGCAAGACGTGGTGTGAACCTCTTTGATAATTGATTCGAACTCGATGCAATGGCGAGTGC
GGTATTGTGCAACTCAATTCGCAGTCACCATACCTATTGGAAACGACTCAAGCGGACTATTTCAGCGTTTTCATCTCTGCGGCCTGAAGCGACAGATCAT
AATGGAAAACCAGAAAGCCAGGCCAAGGTTAACACTCCGAGTCTCGCTGCTGGGCCGCGCCATTCTTCCCGACAAGCATCATCATCATCTGCATGAACTG
CTCGTGTCTGCGGCGGTTCTCGGCGCGCTCTTCGGCGCGTTCTTCGTTGCGGCGGCGCCTCGCCTCGCGCTCTTCGTCGCGTCGGCGATCCTCTTCCTGT
CTCCGCTGTTCCGTCTCTTCCCGTCGGCGTTGCCGTTCCTCATCACGACGCGTTCGCTCTTCCTCGCGATCCAAGTCCCGCTGGTACTGCGAGCGGAGGA
CCACCTTAAGCACAGACGTGAGCAGGTCGTCGCTCGGAGCTGGCGTCGCCTCCGGTGGGAAAATAGCTGCCGGGTTCTGCCACTCCGGACTCTGACGCGG
CGGCGTACGCGCTCGCGCGCGTTGAGCAGGAGCAGGTGAGGCAGCCGCCGGAGCTGAACCTGGAGCTGCAATTGGCGCTGCAGCGGGAGATGAAGCTGTG
ATAGTGGGCGTGGTAGCAGCCACCTCGGATGCAGTGTCCACCCAGCTGTGTTCGGACTCGGTGGCTCCGTCCTGACCTCTCTCCTCACTCTGCGGCGGCT
GGAACGAGGTCTCATTGGGCTCCATTTGATCGCCATCGACGCTGGGCACTGCTCCAGGAGCGGGCGGGACGCCCTCGATCATCTCCTTGTGCACCACATG
GGCGAAGGTGATGGCCTGGTGGTTCTTGGCGCCGCGCGGCGGGATGCTGGACCTGTAGAGCCGCGAAAACTTTTTCTTCAGCGAGTCGGCCGAGCGGTTG
TGCTTGGAAAACTGCTGGTTGTGCAGCTGCGCGACGACGTCCCAGCCTTCGCGCCAGCGCGCGCGCACCAGCTGCAGAAGGCCCATGGACTCAGCCTCCG
TGAAGCCGTCCCCGCGGCGCTGCACGTGCAGTCCGACACGCCGCTTCACCTCGGAGCTCTCCATCGCGTCCGGCGGGGAAAAGCGCGCGGCCATTTTTTT
GAGGGGGACCAAAGAAATTTTGGGTGGATCAAA